Hi there,

If the sequence you have intended to clone contains all the information required for proper expression, the problem comes from cloning and/or expression steps. What kind of plasmid are you using? Have you checked the sequence of the whole region after cloning? What is the protein you want to express? I it potentially toxicfor the cell when expressed at a higher level? Is the protein stable? All these questions should help to sort the situation...

If I understand your question right, I think you need to know if your Promoter is working or not before you can proceed.  There are many ways to discover that such as using Promoter testing plasmids such as pJan25 vectors.  See attached article

Article The pJan25 vector series: An enhancement of the Gateway-comp...

Thank you Dominique adn Ahmed for the answers.  I fused the promoter along with its gene to beta lactamase in frame.  I have checked the sequence after cloning and its fine and in frame.  I transformed in BL21 and checked with beta lactamase antibody for expression and its not expressing.  As this protein is a type three secretion system effector of e. coli, I thought may be there is something missing in BL21 and so, took the plasmid and transformed in those E. coli where this effector is generally present.  This protein is not toxic as the clone I have with plasmids own promoter express well in BL21 and does not degrade.

Hi, Amit,

If I understand you correctlly: you are trying to express a gene with its own promoter in a E. coli BL21. My question is whata is the length of your promoter area( i.e. are you using a minimal promoter regaion, or it still has its regulatory element?). Sometimes, I had a problem to express protein in a different strain of isolate due to the sigma factors or other regulatory factors. I will suggest to look into the promoter region and use the miniiumal promoter only.

Dear Ching, Thanks for the reply!  I took the entire region between the first gene and second gene (desired gene to be expressed) as the promoter region, it has three probable promoter regions.  The size of this sequence is 827 bp and is as below:

TTCGTCTTTGCAGTGACATAAGGTTACTATTCATACATTTTAACGGAGTTGATGATGGGTAATCGTGCAACATTGTATGTAAAGGCAATTCCCCTAATTTTACTGTAGTAAGTGAACATGGCCGGAACGAGACTATCAGCATCATCGGCTTCGGCCCAGTAAAAAGAGGCTCGGAAAAATGCACAATAGGCATCACACGTCATGCATGGATTCAAATTGTACATAATTCAACAGTACAGCTATAAATCGTAAAGAAACTGCAGTACGTTGTGCACAGAAAAGTACCGTGATTCACTATTGTACAGGTCCATTGCAGCAACAATATTTTGTGAATTTTGCGTGAGAGAAAGAAAAGGAATAATTTGTATATAAACAATTGATTAATCAATTGCTGGAAAATAAATAAAACTGATAATTAAAGGCTTAAAGCTTGTATTAAATCATATTTAAAATTTTTTGTTTTAAATGCAGCGTGTTATTGTGTTTTTTTTAATCTATCGGTCTGGTACTTGTAATCAGTGAGTATATCGCACCACTTCAGGATGCTGCAGATTTAGATATTGCGACGGATGAGCAGACATCGTTACTGGCGGCATGGAAGCAGTATCGTATGCCGCTCAATCATGTTGATACGTCTGTATCTCCAGATATCGAGTGACCGGTAATACCTGCGTTATAGTTCGTAAACGTTCGTTTGATGGGATGCTGGAAGGATGAATTAGTTGCCAGATACAAAAAGCAAGAGTTCATTTCTAATTTTTGTTGCCATGTTAGGGGGGATGTTTGTTAAGGAAATTTAGATGGGTTTATTTTGAAGGTTGAAATGT

Can you suggest further? Do you think I should clone the last promoter region only? or the last two? Thanks a lot in advance!

It is hard to say because based on sequence gazing the promoter may go either directions. But it looks like you may have multiple cis- regulatory elements.

Is it very important for you to express the protein from its own promoter? Have you determined the translation or transcription start site?

Hii Ching, Yes, I need to use its own native promoter due to the objective of the experiment.  I already have clones of this gene with plamid promoters that express well. Our question is to how this promoter behave in natural condition when it infects a host cell.

If that is the case, I would say that the regulatory elements are very iimportant for you. Have concider 3'end fusion, or a small tag ?

yes, I have fused the gene with beta lactamase to check the expression. I am also wondering if the expression is so low that I am not able to detect it?  or May be, this protein needs some stress condition to express? 

It is hard to say, because as you mentioned earlier that you can see beta lactamase activities when you put in a different E. coli background. When you did the beta lactamase assay, did you include a control promoter  that you know the level of expression in the E. coli? If the activities of your promoter is not very low when compared to a known promoter, we would worry about the regulatory elements. If your promoter activities is comparable to the known promoter, we would need to worry about the fusion/expression.  Does your protein have post-transcriptional regulatory elements?