I'm going to do relative quantification of my gene of interest but I never worked with these cell lines using real-time PCR. I suggest GAPDH as a reference, but maybe somebody has other ideas?
I too use GAPDH with A549, it all depends what type of treatment you will be doing. HK gene also get affected with the treatments so for each individual expts you have to make sure that the HK gene is not altered.
I think that you should test some different housekeeping genes just to make sure that you actually use the correct one. Unless somebody else have done this before and know which one is the best for these cell lines that you are using?
I too use GAPDH with A549, it all depends what type of treatment you will be doing. HK gene also get affected with the treatments so for each individual expts you have to make sure that the HK gene is not altered.
Cancer cell lines are twitchy. The profiles of GAPDH, ACTB, etc can be all over the place. We've had pretty good luck with 18S rRNA for SYBR Green assays in our ovarian and uterine cancer cells and primary tumor tissues. The primer sequences we've used are FOR: AACTTTCGATGGTAGTCGCCG and REV: CCTTGGATGTGGTAGCCGTTT. The amplicon is 104bp at 60oC.
Dear Philip
How can I access to RefGenes tool? I need it for selection of Reliable reference genes for a real time PCR reaction in ovarian cancer cell line, but unfortunately, I did not succeed to download and install it !
- Badges
- Science method