Hi everyone,
I am going to design a template for in vitro transcription. I add the T7 promoter sequence (taatacgactcactatag) before the target template sequence and insert two other Gs after the T7 promoter sequence (taatacgactcactataggg) to increase transcription yield. I check the RNA secondary structure two times, first by the use of promoter with 1 G and next 3 G containing promoter with mfold (http://www.unafold.org/mfold/applications/rna-folding-form.php). As you see in the attached file 5´ end of the RNAs are involved in secondary structure and their helix δGs are -9.10 and -12.40 respectively. I want to know that is there any problem with second template structure translation as it has lower thermodynamic energy(more stable secondary structure) and higher transcription yield??
- Badges
- Science topic
- Similar topics
- Chemistry, Organic
- Organic