I guess that's a basic question but I can't find an answer.
I am analyzing some SARS-CoV-2 sequencing runs. I often find read alignments like the one in the image.
GACCCGGTGGGTTTTAC---ACTTAAAAACACAGTCTGTAC
GACCCTGTGGGTTTTAC---ACTTAAAAACACAGTCTGTAC
GTTTCAC---ACTTAAAAACACAGTCTGTAC
GGTTTAC---ACTTAAAAGCACAGTCTGTAC
CCACACTCTCCTAGCAC---ACTTAAAAACACAGTCTGTAC
CCACACTCTCCTAGCACCATACTTAAAAACACAGTCTGTAC
It basically says there are reads that share part of a sequence and part of another one. The first 4 reads are the same sequence and it's a sequence that you can effectively find in the official SARS-CoV-2 assembly but the other two reads a mix of this one with another sequence (and both are the same mix) but with only a small (3bps) indel. The sequence of the last two reads does not appear anywhere in the official SARS-CoV-2 sequence.
What does it mean?
Are these sequencing errors? And if that is the case how is it that the same mistake is repeated with similar but not exactly the same data?
And if these are real RNA sequences present in the probe, why are these not used anywhere in the final assembly and how did they arrive there?
Is there any other option that I am missing?