We are experiencing a problem in the DW region despite successfully amplifying the UP region in OE-PCR. The Tm value of the forward primer is 63.4 (excluding the overlap region), and the Tm value of the reverse primer is 63.2.
So far, we have tried Taq Polymerase with Tm values of 61 and 62, touchdown PCR with a range of 58-50, and gradient PCR with a range of 60-48.
We have also attempted using Ranger Polymerase with a gradient of 64-52, but we have not obtained any results.
DWβFW: GACCCGATGAAATTAACGGCCCGCCATAGGCG (overlap)
DWβREV: GGGCGGCCGCATAGAAGCAATATT (NotI)
Protocol :
DNA and F/R Primers = 1 uL
Taq DNA Polymerase = 12.5 uL
Sterile water = 9.5 uL
Does anyone have any suggestions for a solution?