We are experiencing a problem in the DW region despite successfully amplifying the UP region in OE-PCR. The Tm value of the forward primer is 63.4 (excluding the overlap region), and the Tm value of the reverse primer is 63.2.
So far, we have tried Taq Polymerase with Tm values of 61 and 62, touchdown PCR with a range of 58-50, and gradient PCR with a range of 60-48.
We have also attempted using Ranger Polymerase with a gradient of 64-52, but we have not obtained any results.
DWβFW: GACCCGATGAAATTAACGGCCCGCCATAGGCG (overlap)
DWβREV: GGGCGGCCGCATAGAAGCAATATT (NotI)
Protocol :
DNA and F/R Primers = 1 uL
Taq DNA Polymerase = 12.5 uL
Sterile water = 9.5 uL
Does anyone have any suggestions for a solution?
Your pcr is being tested at low temperatures so if the template is high GC then secondary structure may be a problem. You could try running the pcr in a final concentration of 1 molar betaine or including up to 8% DMSO ( or even use both in the same reaction) to minimise the effects of loops in the dna/primers or G quadruplex formation,
If you are not getting any results in OE-PCR (overlap extension PCR), there are several potential issues that could be causing the problem. Here are some troubleshooting steps that you can take:
Paul has a good suggestion, I wouldn't be surprised if your problem was stemming from secondary structures as also suggested by the use of high-gc buffer in the protocol below:
Preprint Overlap extension PCR v1
Sıla Unlu
As you know in OE-PCR , overlap region plays role as a primer for each opposite sides to extend the fragment and form a whole segment.
I got positive result Based on Hilgarth, R. S., & Lanigan, T. M. (2020) method, which is a two step PCR. In first step you need to run a PCR without external primers and only with equal molar mass (same ng) of both fragments you want to attach them together (which you amplified them before separately), for 10-15 cycles and based on overlap region Tm (which is different to external primers Tm). By this step, since you have provided polymerase and other needed material in the reaction for a PCR (except of primers), overlap region will play role as a primer for each side and form some complete fragments as templates.
Then, in second step, you stop the PCR machine for some seconds and add the external primers and run the PCR for 20-25 cycles, and this time based on external primers Tm. Now your primers use templates of last step to amplify in large amounts.
Highly recommended to use a high fidelity polymerase for OE-PCR, specially if you need to insert any mutation inside as well.
Good luck
Well done for finding the problem Sıla Unlu . Good luck when the new primer arrives
- Badges
- Science topic