Viral positive controls ?

More Alene Geteneh's questions See All

CMV- PCR versus IgM ELISA for studying co-infection ?

We have been looking for the fueling effects of cytomegalovirus on HIVpositive patients. patients serum was tested for CMV by PCR and ELISA for IgM. We found discrepant results, that IgM positives...

12 October 2020 5,262 2 View

is there any mechanism to differentiate primer dimmer from real amplicon in case of targeting small DNA fragment?

for variciella zoster with primer sequence sense 5`GCGCGGTAGTAACAGAGAATTTC 3` and antisense of 5` ACGTGCATGGACCGGTTAAT 3`

06 November 2019 8,082 3 View

How can I prepare virus for a TEM or SEM imaging?

I have virus (viral hemorrhagic septicemia virus) in suspension and the experiment will not involve cells. What level of TCID50 is preferred?

11 August 2024 3,115 1 View

Who of all the Global Scientific community will help me Prof. Dr. Yoshida make way for TPEOM, MEC ~EMC to return the atmospheric gases to the norma ?

TEP presentation caption (The Environmental Project) Re: Why should Washington’s DC, or any country government point of location think of as nowadays of as to being 'tomorrow as to come! if it...

03 August 2024 2,484 1 View

Which is more important: The human factor or the technological factor in combating climate change?

On a personal note, even though technology has attracted a lot of interest and funding to combat climate change, it is becoming more and more clear that taking care of the "Human Dimension" is...

02 August 2024 6,773 12 View

How to retain the a GFP tagged gene expression in stable cell line?

Hello , I established a stable cell line expressing GFP tagged to a centrosomal gene having G418 drug selection marker. I validated the stable line by IFA and Western blotting, results are fine....

29 July 2024 5,007 0 View

In terms of chaos, what is the necessary and sufficient condition for authoritarianism, permanent or temporary, to come to exist and persist?

Since 2016 Brexit, the world needed to change the thinking behind traditional democracy as the democratic landscape changed, yet traditional democratic thinkers and actors have been acting as if...

28 July 2024 6,515 1 View

What is effective targeted chaos?

Perfect democracy thinking assumes no chaos so no need for independent rule of law system and liberal democracies assume the possibility of normal democratic chaos that can be sorted out by an...

28 July 2024 473 1 View

I want to get updates regarding international law, international trade law, international institutions and human rights etc?

Please send me updates regarding the above-mentioned areas in the question mark?

28 July 2024 5,197 3 View

How can I calculate the SOD enzymatic activities using the spectrophotometer method?

I have to quantify the enzymatic activities of SOD in plants using a method that employs hypoxanthine-xanthine oxidase to create O2. The colorimetric reaction was performed by combining...

23 July 2024 8,492 3 View

How does the human microbiome influence health and disease, including implications for personalized medicine and microbiome-targeted therapies?

Probiotics related.

22 July 2024 1,707 2 View

What is human-computer interaction (HCI)?

22 July 2024 10,056 2 View

Marcos Vinícius Pereira Gondim

Dear Alene,

You can search into the NIH Reagent Program. If you or your PI have a register there you may get a limited number of free samples from them.

Hope it helps.

Ebubechukwu Ezeonwumelu

I agree with Marcos Vinicius Pereira Gondim.

Alene Geteneh

thanks guys for your information. would tell me how could i be the member of the NIH reagent program please?