I have to do luciferase assay, and the promoter that i am going to use consists of a sequence from -330 to +361 which has ATG at +1. My question is when I clone this promoter in luciferase containing vector (pgl3), where will protein synthesis start at +1 of promoter or from luciferase ATG?
Some questions/remarks:
-Does this ATG correspond to a real methionine codon, actually used for translation of a protein, with a Kozak environment, or did you just happen to find ATG in the sequence?
- +1 usually defines the transcription start site, not the translation start. This RNA has no 5' UTR whatsoever? That sounds unusual.
- If it's really an ATG "codon", depending on the frame, luciferase will not be produced at all (if different reading frame), or as a fusion protein (if same frame).
But my guess is that +1 is actually the Transcription Start Site, so you shouldn't worry about that.
You need to make sure that the luciferase CDS is in-frame with your promoter, thus the actually translation start point is your first ATG (in your promoter). However, since your luciferase contains the start codon ATG, you do not need to include the ATG from your gene, just fuse the promoter region upstream of the luciferase (in-frame).
I agree with Vincent - your promoter probably uses the "+1" as a transcription start site. The pGL3 vector (if it's the Promega one) looks like it is designed to have the promoter added, and the luciferase should then be translated fine as it has the correct translation initiation.
This is my promoter sequence of htert
5'tcgggttaccccacagcctaggccgattcgacctctctccgctggggccctcgctggcgtccctgcaccctgggagcgcgagcggcgcgcgggcggggaagcgcggcccagacccccgggtccgcccggagcagctgcgctgtcggggccaggccgggctcccagtggattcgcgggcacagacgcccaggaccgcgcttcccacgtggcggagggactggggacccgggcacccgtcctgccccttcaccttccagctccgcctcctccgcgcggaccccgccccgtcccgacccctcccgggtccccggcccagccccctccgggccctcccagcccctccccttcctttccgcggccccgccctctcctcgcggcgcgagtttcaggcagcgctgcgtcctgctgcgcacgtgggaagccctggccccggccacccccgcgatgccgcgcgctccccgctgccgagccgtgcgctccctgctgcgcagccactaccgcgaggtgctgccgctggccacgttcgtgcggcgcctggggccccagggctggcggctggtgcagcgcggggacccggcggctttccgcgcgctggtggcccagtgcctggtgtgcgtgccctgggacgcacggccgccccccgccgccccctccttccgccaggtgggcctccccggggtcggcgtccggctggggttgagggcggccggggggaaccagcgacatgcggaga 3'
and the yellowish region is showing cdna sequence start with atg and it is also designed +1. So when i will clone this promoter in pgl4 luciferase vector then what will happen, will i get fusion protein or no protein at all?
- Badges
- Science topic
- Similar topics
- Biological Science
- Molecular Biology