We are going to use custom TaqMan TM Advanced miRNA Assays for microRNA quantification experiments in plants. These assays are not compatible with the use of U6 snRNA as a reference internal sRNA. Therefore, we are seeking suggestions on miRNAs that have been proved to be stable in plant leaf tissues under biotic stress conditions. Any experiences or any ideas? Many thanks in advance for your support.
Fabrizio
Dear Fabrizio,
In order to find suitable miRNA normalizator for our miRNA RT-qPCR quantification studies, we analyzed many small RNA sequencing dataset of potato plants that were uninfected or infected with a range of viruses, such as PVY, PLRV, PVS, PVX, PVT. By comparing the expression levels between infected vs. non -infected samples we found this stu-miR167a-5p.1 (TGAAGCTGCCAGCATGATCTAA) to be the most stably expressed. You can read more about our RT-qPCR setup in our manuscript doi: https://doi.org/10.1101/130757 or perform similar analysis on your small RNA sequencing samples.
Excellent Maja, thank you very much for the advice. I will have a look to your work, too!
Kind regards
- Badges
- Science topic
- Similar topics
- Chemistry
- Biochemistry
- Biomolecules
- Nucleic Acids
- RNA
- Small RNA