I have done the Real Time PCR for SNP genotyping with TaqMan probe genotyping assays for 1000 patients. In this method, we have detected the SNP with VIC and FAM due to TaqMan. It is characterized by the green and yellow colors.
Now, how do we distinguish that whether VIC or FAM detected the SNP?
Thank you there.
in this link:
https://www.thermofisher.com/co/en/home/life-science/pcr/real-time-pcr/real-time-pcr-assays/snp-genotyping-taqman-assays.html
tipiyng of rs1051730., after click en search.
after click in assay ID. and this is your information:
Context Sequence [VIC/FAM]:
AGCAGTTGTACTTGATGTCGTGTTT[A/G]TAGCCTGGGGCTTTGATGATGGCCC.
VIC is allele A and FAM is allele G.
Best regards
Leonardo
Using the channel that detects the fluorescence of each fluorochrome (VIC or FAM), then you must know which base of the SNP is marked with VIC and which with FAM.
Thank you, Leonardo beltrán
Ok, but how we know which base of the SNP is marked with VIC and which with FAM?
Abdolhaim,
Did you use taqman tests pre-designed by applied biosystems or thermo? or Were probes designed and synthesized by demand?
Leonardo beltrán
We used taqman tests pre-designed by applied biosystems, for CHRNA3 gen and rs number is rs1051730.
Thank you.
in this link:
https://www.thermofisher.com/co/en/home/life-science/pcr/real-time-pcr/real-time-pcr-assays/snp-genotyping-taqman-assays.html
tipiyng of rs1051730., after click en search.
after click in assay ID. and this is your information:
Context Sequence [VIC/FAM]:
AGCAGTTGTACTTGATGTCGTGTTT[A/G]TAGCCTGGGGCTTTGATGATGGCCC.
VIC is allele A and FAM is allele G.
Best regards
Leonardo
Dear Abdolhalim,
In order to keep all this information together you should introduce all this data into the software (I use QuantStudioRealTime PCR software, the software for 7500 is similar) to create your library, as well as descriptive information regarding the assay you use. It will be very useful once you will increase the number of SNPs to check (we work on almost 20 SNPs for about 4000 samples)
Let me know if you would like to do this, I can prepare some printscreens for you and post them on Research Gate.
Good luck!
Dear Levitchi,
Thanks for the guidance.
if possible please, send some print-screens in research gate.
Best regard.
- Badges
- Science topic
- Similar topics
- Microbiology
- Assays