I am testing some PCR primers I designed and I'm having some multiple-banding and sequencing issues with them. I wanted to BLAST them to see what else they may be priming besides the intended target. Everything I have read on Primer-BLAST says to check the specificity primers simply input both primer sequences, choose a database and click "get primers". When I do this I get the error:
Specified left primer not in Included Region; Specified right primer not in Included Region.
I have tried numerous changes to my input and I always get this error. My primers have degenerate bases in them. Does anyone know if these cause Primer-BLAST problems? Are there any good alternatives out there for checking primer specificity?
Just tried it, Primer-Blast can handle degenerate bases. Did you get the same error when your input does not contain the degenerate bases?
No. I do not get the error when I remove the degeneracies, but it also does not give me a result. It returns "no primers were found". This seems odd since I am not asking it to find primers. I gave it primers and would like to know what will be amplified. Since I know it amplifies the nirS gene from an organism in the database (my own results) I should get that result at the least, right? And it only seems to give an error with the degenarate bases.
Strange, are you sure all the other settings are correct? i.e. change the organism from Homo sapiens to your organism of interest, use nr instead of refseq mRNA
The primers I was testing were:
forward: TTTCTCAGCCATCACAGTCG
reverse: CGACCTCCTCATCGGTGTAT
and it didn't matter if I changed to:
forward: NNNCTCAGCCATCACAGTCG
reverse: NNNCCTCCTCATCGGTGTAT
If you just type it in to normal nucleotide blast then it should be fine. It will then bring up a list of what that particular sequence belongs to. I have just had the same issue myself.
I was having the same problem. It seems that NCBI Primer-BLAST takes "N" (although it will never find you any target template for your primers...) but does not take any other IUPAC nucleotide code (e.g. R, Y, S, W, etc.).
Hi, I'm having the same problem. Did anyone find a tool or software to do it?
Thank you.
You can also try this tool https://www.thermofisher.com/in/en/home/brands/thermo-scientific/molecular-biology/molecular-biology-learning-center/molecular-biology-resource-library/thermo-scientific-web-tools/multiple-primer-analyzer.html It accepts degenerate primers
Also having this issue. Still unsolved.
I have tried both of the programs suggested here. MFEprimer may work if you are looking at a very specific sample set (like all human genome) but does not include all sequences which I need for microbial ecology. The thermofisher doesn't run primers against databases at all.
Maybe there is a program that can convert the degenerate sequences into a fasta file of unambiguous sequences which can be blasted?
- Badges
- Science method