i need the corresponding formulas for calculation of pectin and hemicellulose contents of roots. Please help me?

More Servet Aras's questions See All

What is the effect protein on the Malt Processing ?

Protein content in malt processing can have several effects, primarily related to its impact on the enzymatic activity during mashing and its influence on the final characteristics of the malt and...

29 May 2024 4,074 2 View

CGCGGGGTGGAGCAGTCTGGCAGCTCGTCGGGCTCATA, and what best forward primer I can use for this sequence, and how to control not pick up unwanted organism?

my primer dedect many unwanted organism how can control this problem?

21 September 2023 5,955 5 View

My housekeeping gene has higher CT values than the interested samples. How can I overcome this issue?

I have been doing some qPCRs on bacterial genomic DNA. I am using 16S as my "housekeeping gene". My sample of interest, however, yield a lower CT value. I am trying to figure out how to overcome...

20 April 2023 2,121 3 View

Cellulose reinforcement Lignocellulose film ?

I am preparing a lignocellulose film with cellulose nanocrystal additive using TFA as a solvent. My aim is to improve the stress values, but I haven't seen any improvement. I am having difficulty...

16 April 2023 7,083 0 View

I want to have the weather condition at the time level(level2) as well. H: How should I write it in RStudio?

I have three levels: individual level, time (days of the week), and environment level, but I need that use the weather condition of the day in level time together (It means to have time and...

02 February 2023 4,176 0 View

What is the wavelength of the adsorption spectrum of As, Cd, Hg, Pb,Cu elements in the visible region in the pH4 buffer in the UV spectrum? Thank you?

What is the wavelength of the adsorption spectrum of As elements in the visible region in the pH 4 buffer in the UV spectrum? I would appreciate it if anyone has knowledge. Thank you.

25 March 2022 5,098 2 View

How can I isolate RNA and synthesis cDNA from mouse serum samples?

I obtained mouse serum samples. My initial plan is to check some proteins using ELISA. However, plans have changed and now I need to check some gene expressions. My questions are: 1) Can I...

08 June 2021 823 3 View

Do I need to introduce HFD to ob/ob mice to obtain a T2DM model?

I am planning to work on T2 diabetic animals and check the efficacy of probiotics. My initial plan is to fed B6 animals with HFD for a while. But now, I have the chance to work on ob/ob mice. My...

18 February 2021 7,202 3 View

Plaxis 3D calculation while getting Error code 204 on when active Embedded Beam in tunnel models?

I modelling design of umbrella arch and pipe arch in Plaxis 3D. But I could not excavate while actived embedded beams. We encounter failure slow convergence (204). I read reference manual page...

01 March 2019 103 20 View

How can I find Baotite mineral JCBDS number?

I can not find number of Baotite mineral XRD JCBS to my paper

13 December 2018 7,330 3 View

Which type of compound does lamda max of 218 indicate in a uv-vis spectrum of a partially purified compound through column and TLC?

A crude extract of fungal culture using EtOH was subjected to column and TLC and partially purified compound was obtained. UV vis spectrum of the compound/s has max absorbance at 218nm. The...

11 August 2024 9,801 2 View

Baseline drift in HPLC? What causes this?

Hello, Why do i see this baseline drift when i compare my blank (black) to the sample (blue)? Any suggestions as to why this happened? Thank you!

11 August 2024 3,770 4 View

What may be the reasons for failures of Tube toi Tube Sheet Joints in Boiler Drum ?

We have observed that tube to tube sheet joint leaked in our boiler and needs to overcome same by knowing the root cause.

08 August 2024 3,161 0 View

How do soil microflora interact with plant roots and influence plant nutrition, health, and productivity?

06 August 2024 9,618 3 View

Can a Conventional 50W visible LED Lamp Emit UV Light?

I'm researching light sources and their UV emissions. I'm curious if a 50W, 7500K conventional LED lamp emits any UV light. I found that a 200W tungsten lamp can emit up to 1.5 mW/cm² at 350 nm....

31 July 2024 3,843 7 View

How microorganisms are important for maintaining of healthy soil and biodiversity and microorganisms and plant roots contribute to soil formation?

31 July 2024 8,939 5 View

How can we calculate the percentage of configuration interaction (CI) in the UV output data of the Gaussian program?

How can we calculate the percentage of configuration interaction (CI) in the UV output data of the Gaussian program? for example: Excited State 17: Singlet-A 5.1359 eV 241.41 nm...

28 July 2024 9,165 2 View

Is there a method to measure the concentration of Cs, Sr, Co using spectrophotometer?

it's important to know that we are using the inactive elements of Cs, Sr, Co

25 July 2024 1,553 2 View

Granger causality construction for VECM model?

Dear people,

24 July 2024 1,252 2 View

What does negative readings in spectrophotometer denote. Was testing TSS content of bacterial cultures?

I was performing estimation of Total Soluble Sugar content in bacterial cultures by Anthrone method. Out of 9 samples, only one sample showed positive reading while others had a negative reading...

22 July 2024 9,576 4 View

Catherine M G C Renard

.There is no such thing, as all the reactions used to measure sugars or yronic acid are too sensitive to precise reaction conditions, you should actually do a calibration curve each day.

And as pectins and hemicellulose are both composite classes, there is not really satisfactory determination except by analysis of the different sugars present after extraction and purification.

Servet Aras

Thank you for help.