More info needed. How many base pairs bind to your target?

size of template (ORF) is 1350 bp. I use taq dna polymerase and taq buffer for running pcr, together with dntps, his-tag primer, dh2o and dna template.

Budak, there's a difference with normal PCR since you are working with an excess of template (your cloned gene to which you are adding the Hys-tag).

When setting the reaction you must consider the Tm of only the fragment of the primer that it is actually annealing. If you consider the Tm of the entire primer (88.8 C!!) you will be annealing at 84C, and this is clearly a too high temperature.

If you plan to clone the tagged fragment, do not forget to add a few nucleotides extra at the 5'end of your primer to facilitate restriction enzyme cutting. At the end of the "New England Biolabs" catalogue there's a technical reference section in which you will find a table showing the number of extra bases that different REs require for optinal cuting

Disclaimer: No relationship with NEB other than using its products.

is it possible to have high annealing temp (e.g >80c) for running pcr with taq system and N-terminal his-tagged primer?

I think the point that Estanis made is that your annealing temperature is NOT based on a Tm of 88.8C. Your primer will NOT anneal if you use this Tm to calculate the annealing tmep. The melting temp that the oligo supplier gives you assumes that the full length of the primer is annealing to its complementary sequence. In your case only a small length of your primer is annealing to your target DNA (in the first amplifications). You have to take that homologous sequence (only) and calculate the Tm for that hybridization. That will then allow you to calculate your correct annealing temperature. If you use 88.8C as a basis, your primer probably will never anneal to the template in the first amplification and you will get no product. There are certain circumstances where you can use high annealing temperatures, e.g. to avoid artefacts when making complex mutated inserts with large non-homologous primers, but that doesn't seem to be what you are doing.

This is my example of N-terminal his-tag primer to be used for amplifying template of interest using pcr,. can I amplify template of interest without C-terminal his tag primer for that template,using only N-terminal his-tag primer as shown below.

5’-ATGCATCATCACCATCACCACGAGAAAGCCATCGACAGGCAGGGAGTACTT-3’

I don't really know what you are doing, but I don't see a 5' restriction site, so how are you going to clone it? Also, I don't know if you have a linker in there, so I don't know what part of the sequence is actually homologous to your template, so I can't comment on annealing temp. Yes, you do need a downstream primer if you are using conventional PCR to amplify. The reverse primer may need to incorporate a stop codon (which may already be in your template) and it usually needs to incorporate a 3' restriction site. The restriction sites should be chosen to allow directional cloning into your vector. The homologous part of the reverse primer should have a Tm very close to the Tm for the homologous part of your forward primer. Also, to allow you to cut your restriction sites prior to ligating into your cut vector, you need to have overhangs, as was mentioned by Estanis, above.

BLAST of your sequence gives NO hits in any database, so I suggest you check your sequence carefully to make sure that it actually corresponds to your template.

Hey Budak.

As previous people already stated, you need to consider that initially only your gene-specific part of the primer will anneal to the target DNA. Thus, I think you have 6x His which doesn't need to be considered for annealing temp in your sequence, and then, depending whether you integrated also a linker between the 6x His and your gene or not, you take the remaining nucleotides to calculate the annealing temp again. What works pretty well for me when using similar designed primers is to have ~ 10 PCR cycles with annealing temp calculated only for the gene-specific part of the primer followed by 20-25 PCR cycles with annealing temp the same like the synthesis temp. (2 comments on that: a) within the first 10 cycles you may have amplified a couple of strands from your original DNA template containing already the His-sequence, thus your primer now have a longer sequence to anneal to and higher temp brings higher specificity, b) it doesn't make sense to consider annealing temp above the synthesis temp because the lowest temp defines the annealing temp being "used" by the primer)

I hope this helps a bit. Good luck!

As a comment to Norbert: with simple TA-cloning you don't need a restriction site upstream of the His-tag, sometimes even blunt-end cloning gives some results (although much more unlikely than overhang cloning). anyway, since the primer is already pretty long due to the His-tag, I guess Budak decided not to extend it even more by some 6 + 4-6 bp for restriction site... just a guess :)

Fair enough, Martin. I personally find TA cloning very frustrating. I have successfully used primers with non-homologous sequences as long as 76 bases, and I have heard of success with primers well over 100 bases. One tip for using long primers is you MUST cartridge purify the primer. I also find that proofreading polymerases are better than Taq for this. And I always use LaserGene to optimize my primer design. Using long primers is not for beginners, however.... and there is also some luck involved!

From that primer, the homologous part to my template as shown below:-

GAGAAAGCCATCGACAGGCAGGGAGTACTT

At 5' end,it's ATG(start codon),and then, 6x-His tag and after that, my homologous sequence to my my template (5' to 3'). The size is 30 bp.

hello! I wonder if theres a protocol or a manual where i can read more about his tag primers! thanks in advanced :)