How to Identify the tuples fall in False Negatives in Confusion Matrix?

More Ramesh Eluri's questions See All

I want know is there any code/program which give the count of Vehicle (Moving object) in matlab?

I have completed my noise monitoring and videography ( for traffic volume count) survey ,And I just want to count vehicles moving on road , So let me know is there any code or program in MATLAB to...

24 December 2020 3,316 1 View

One way or Two way ANOVA?

Dear All, I have one dependent variable and three independent variables and wanted to apply ANOVA as a measurement. However these variables do not have any levels or categories. Please suggest...

01 December 2020 2,069 8 View

Here we are fabricating Perovskite solar cell in air atmosphere, even for standard cell also not getting PCE more than 1.5% but in reports PCE is 15%?

Hi, I am PhD student working on Perovskite solar cells (PSCs), I have fabricated standard cell (FTO/C-TiO2/M-TiO2/CH3NH3PbI3/Spiro-OmeTAD/Ag) in air atmosphere. but i am not getting any...

06 October 2020 8,168 8 View

I want to simulate a VAR model. How do I choose the coefficients to ensure stability?

I know how to compute eigenvalues to test stability. The question If i have for example a 10 node model with 5 lags, how do i choose stable parameters without just guessing.

06 October 2020 5,238 6 View

Best techniques available for the VOCs adsorption by MOFs?

I am very new to MOF-field. I really need your help, can anybody please suggest me which is a simple and best technique to do VOCs adsorption studies for MOFs? In our lab we have GC-MS and my big...

05 October 2020 8,874 2 View

The ratio of hypocholesterolemic/hypercholesterolemic (h/H) fatty acids?

The following equation is generally used for the calculations of the ratio of hypocholesterolemic /hypercholesterolemic (h/H) fatty acids, or h/H fatty acids index (Santos-Silva et al. 2002;...

24 September 2020 9,939 5 View

Stagetips for desalting small molecules (not peptides)?

I work with derivatized neurotransmitter molecules. I was using C-18 SPE cartridges previously for desalting them before LC-MS, but now I would like to adopt in-house made stagetips. These are a...

22 September 2020 4,854 6 View

Is there any quantitative measure of Interdependence between different data-variables ?

In my observed data I have different data variables(12 in Number) , Let say X1,X2......X12..I want know ,How one data variable influence the value of another data variable.. is this...

11 May 2020 2,968 1 View

How to design a Spaceborne Antenna for HEO (Highly elliptical orbit) satellites? What types of Antenna are useful for this purpose?

29 April 2020 9,604 1 View

Will three missing nucleotides on the 3' end of the forward primer result in no annealing?

Hello everyone, I ordered forward and reverse primers for oligo annealing for guided RNA cloning. Instead of this primer (5' CTTCGCTAGAGGCGTGGCCAGGGG 3'), I ordered this...

25 March 2020 551 5 View

Why should we choose deep learning to machine learning? Why is CNN better for image classification? Can I get Typical Answer?

What Characteristics makes CNN work better?

03 March 2021 1,458 4 View

What are some of the research gaps in machine learning and artificial intelligence in africa?

i would to know some of the research gaps in the artificial intelligence field in most african countries.

03 March 2021 6,145 3 View

Anyone plz suggest relevant topic for research in image processing+Deep learning.?

I have selected brain tumor images ...but now found that already lots of research done n this topic.

03 March 2021 5,774 3 View

What's the best way to measure growth rates in House sparrow chicks from day 2 to day 10?

What's the best way to measure growth rates in House sparrow chicks from day 2 to day 10? Since, the growth curve from day 2 to 10 won't be like the "Logistic curve" it might not follow logistic...

03 March 2021 1,401 3 View

After a reference from Int J Body Compos Res, can any body help?

Hi, I am after the reference below, my library says it cannot obtain a copy either locally or internationally, any help appreciated! Chris Wang ZM, Heshka S, Wielopolski L, Pi-Sunyer FX, Pierson...

03 March 2021 6,193 1 View

How to increase a model accuracy ?

dear community, my model is based feature extraction from non stationary signals using discrete Wavelet Transform and then using statistical features then machine learning classifiers in order to...

03 March 2021 6,994 5 View

What techniques can I use to determine the miscibility of polymer blends?

The term miscibility refers to the single-phase state in thermodynamics. I do not mean the compatibility of different components. To determine the miscibility I know several techniques such as...

03 March 2021 4,107 4 View

How to repeat an operation on an atom selection for multiple times in PyMol?

Hi, I am trying to construct a multi-layer fibril structure from a single layer in PyMol by translating the layer along the fibril axis. For now, I am able to use the Translate command in PyMol...

02 March 2021 4,569 4 View

Can you share me how teacher education is managed in your respective national educational system?

I feel that the practice in teacher education in my country is below the expected performance level due to very poor management system. Hope I will learn something from your experiences.

02 March 2021 1,516 4 View

Can NFL theorem be valid in infinite search space in ML?

NFL theorem is valid for algorithms training in fixed training set. However, the general characteristic of algorithms in expanded or open dataset has not been proved yet. Could you show your...

01 March 2021 1,189 3 View

Md Hasan Al Banna

You can predict each sample and map it so that you know what samples were FN and what are the other samples.

Muhammad Ali

Have a look at https://towardsdatascience.com/a-non-confusing-guide-to-confusion-matrix-7071d2c2204f

Leonid Kupershtein

you must manually analyze results of your classification model and estimate which example take false value