I'm interested to quantify Urea by HPLC method, reversed phase conditions are preferable. Is there a good method suited for urea?

I have to develop a method that can be good enough to run dozens of samples that include urea as the main compound. I prefer an HPLC method because of the convenience of running large numbers of...

01 February 2021 1,888 4 View

How to convert ng/ul of DNA concentration to pmol/ul ?

Dear researcher, After amplifying my target gene (1900bp) into the required cDNA by PCR,>cut specific gel bands and purify the gel and the concentration was 30ng/ul. Next, performed A-Tailing...

21 January 2021 2,671 3 View

Can use Unigenes from RNA sequences for overexpression studies (transformation) without requiring a specific plant genome?

Dear researchers: If the plant genome has not been released yet, can Unigenes from RNA sequences be used after BLAST and confirmed with known Arabidopsis genes for function/overexpression...

20 January 2021 5,557 2 View

What is the reason of weight gain in TGA curve of a HDPE polymer sample ?

HDPE samples were aged at higher temperatures in the presence of water and CO2 than the TGA test was performed in Nitrogen? Weight gain is seen in the curve? What could be the possible reason for...

16 January 2021 5,644 2 View

Can BLAST/ search by using known Domain in Transcriptome/Genome data for a gene family?

Dear Researchers, I have Transcriptome/Genome data and want to list all the member of a KCS/CER gene family whose Domain AP2/ERF, FAE1_CUT1, according to the Arabidopsis database, so is there...

15 January 2021 2,293 3 View

Is it necessary to measure the concentration of PCR/Gel purified product for A-tailing and TA cloning?

Dear Researchers, While working on plant gene transformation, so after cDNA + Gene Primer amplification, >the PCR/Gel were purified, so next for A-tailing and TA cloning is mandatory to...

12 January 2021 3,272 34 View

Can use the same vector for overexpression and transient expression?

Dear Researchers, I am using pCAMBIA1301/1302 vectors for overexpression study, so can use the same vectors for transient expression? or need to design another vector for transient expression;...

08 January 2021 7,975 2 View

Why negative controls also showing the specific bands of promotor and other regions (GUS, GFP etc.)?

Dear Researchers, I did a transformation of an empty vector (pCAMBIA1301/1302) into my passion fruit plants, for the optimization of the transformation protocol. After transformation; DNA...

06 January 2021 8,465 99 View

Can anybody help me out in TRNSYS about short term thermal energy storage used as buffer storage ..?

i am a beginner in trnsys and need help ... can anyone please guide me

20 December 2020 1,040 3 View

Smear in PCR product after purification, how to get rid of it?

I've done a PCR using primers Forward: CGCCATCAAGGTACCAGTTGA and Reverse: CAGGCTCAGGTACAGCTGGTGG AGTCTGG saw a band at around 400bp and purified my PCR product using QIAquick PCR Purification...

28 November 2020 1,701 7 View

How can I improve the concentration of banana fruits extracted RNA?

Currently, I'm working with banana fruits. I've tried to do RNA extractions with different methods, and I've gotten total RNA without contamination, but I couldn't get a high concentration of...

22 February 2021 6,126 2 View

Does calculating the interaction index between a drug and a food matrix make sense?

Dear all, I'm conducting the revisions of some of my manuscript, with is the impact of the combination of Aspirin and a fruit juice in colorectal cancer cells. Two of the reviewers have asked to...

16 February 2021 3,141 3 View

Why is there cloudy white solution in flavonoid test tube?

I do flavonoid test for biscuit incorporated with muntingia fruit powder. Sample extracted with metanol (1:10 ,w/v), macerated 24h, sentrifuged and filtered. Supernatan used for analysis. I have...

08 February 2021 6,779 4 View

Does the UV radiation affect on fruits ?

I want to examine a kind of fruit's extract's antimicrobial effects. At first I want to put it under the UV radiation to prevent the mold or any kind of fungi's and bacteria's growth. The...

24 January 2021 8,350 20 View

Can any one suggest the name of Litchi insect/predator?

Is it a type of Ambush bug or what? Thanks

14 January 2021 9,381 3 View

Can I make a meta-analysis with different variables in the same forest plot?

14 January 2021 1,733 4 View

How to determine the genetic potential of the genotype in terms of fruit size and weight?

In addition to genetic and environmental factors, fruit size is also influenced by crop load, rootstock, orchard planting system/tree training system, pollination, water and nutrient management,...

13 January 2021 9,309 4 View

What steps should one take to address post-harvest disease problems in a supply chain?

If I were to receive an import of a new fruit species in the country and, upon arrival, the whole lot was diseased, what steps do I take to diagnose and solve the problem? Is there a general...

10 January 2021 1,649 7 View

How we can isolate" distinguish" between Tyrophagus putrescentiae and T. entomophus ?

If I want to isolate Tyrophagus entomophagus by selective media, as I know they can grow on molds of stored grains,fruits, cheese. Or even in beehives debris. But how can I got only one species...

30 November 2020 9,087 3 View

How do I remove Bacillus sp. spores from Kraft Paper machine?

In the pulp and paper company that I work in, samples from paper, water and pulp from the paper machine gave information about existing spores of Presumptive Bacillus cereus. Our paper is used...

03 November 2020 1,726 10 View