I’m Using a water gas shift reaction with a high temperature shift in an adiabatic Packed bed reactor to synthesise ammonia. I’m struggling to find the correct rate equation and therefore volume of my reactor. could anyone help?
Article Modeling and Simulation of Ammonia Synthesis in Fluidized Bed Reactor
https://www.researchgate.net/publication/328928954_Modeling_and_Simulation_of_Ammonia_Synthesis_in_Fluidized_Bed_Reactor
Article Process Intensification for Ammonia Synthesis in Multibed Re...
The solar photovoltaic (PV) power plant uses commercial (non-concentrated) PV modules which are quite simple in design and reliable. They can work on fixed orientation and don't need the moving...
16 February 2021 3,796 9 View
Dear researchers, I wish to understand the role of grain growth inhibitor in controlling the microstructure of the ceramic pellet. How it controls the growth? Also, I wish to know the grain...
15 January 2021 3,859 3 View
Sympatric birds may avoid competition via multiple strategies - by different activity period, different diet, different microhabitat etc. Has any one looked into behavior of sympatric birds as...
11 January 2021 9,600 1 View
Can anyone help me with the FEM coding for Buckling of composite plates using the FSDT or HSDT - Source or the helping material (textbook, research paper etc) - Geometric stiffness matrix...
03 January 2021 3,059 3 View
Hi all, I wish to know about a common problem faced by most of the researchers who are dealing with ceramic materials that my ceramic powder is sticking with the balls after the operation. can...
02 December 2020 8,232 3 View
I've done a PCR using primers Forward: CGCCATCAAGGTACCAGTTGA and Reverse: CAGGCTCAGGTACAGCTGGTGG AGTCTGG saw a band at around 400bp and purified my PCR product using QIAquick PCR Purification...
28 November 2020 1,701 7 View
somebody, please elaborate on how to calculate exergy destruction in kW units. from Aspen HYSYS I found mass exergy with kJ/kg unit and i don't know how to calculate it by using Aspen HYSYS and if...
25 November 2020 2,675 3 View
This is what I have for my hypotheses at the moment - is this an okay to write it or how should I format it (this makes sense to me but I haven't seen hypotheses written like this before)? Any...
15 November 2020 994 2 View
I am working on Radar Emitter Classifiers and I want test my codes. unfortunately I'm unable to find a dataset to test my algorithms. I'll be glad if someone can help me with this...
04 November 2020 3,988 3 View
I am wondering if anyone has made Lipoic acid with a terminal amine and has seen gelation? Is there anyway around this or a way to get it back into solution?
29 October 2020 2,839 1 View
03 March 2021 8,272 1 View
I have dataset which shows the length of power lines. I need to classify the lines based on the line length. Is there a rule to classify the High voltage (HV) and low voltage (LV) lines based on...
03 March 2021 4,116 4 View
Hello, We would like to increase the yield of our PCR product. We are running a series of PCR reactions that is targeting ~1.1kb sequence. We begin each reaction with ~400pg of template DNA...
02 March 2021 4,029 3 View
I am using a 2707 waters HPLC device. When I try to inject a sample, it says missing plate or rack. I changed the needle and calibrated its position but I still get the same problem. I even get...
02 March 2021 1,408 1 View
(This statement is from wikipedia, BTW). What is so special about metallic bond that is limiting high-P low-T state of a matter (as long as individual atoms exist, not white dwarf of neutron star...
02 March 2021 3,309 2 View
Hi, I am planning to apply for the PhD degree in the Supply Chain Mgt. with specific area of "Cold Storage warehouses" during Pandemics and wars. Where lock downs and shut downs are frequent....
02 March 2021 285 2 View
So, I have been trying to run a pACYC PCR which will be used later on for a Gibson Assembly. However the PCR is not working. I have already tried gradient PCR and changing extension time; however...
02 March 2021 1,146 2 View
I am going to have 3 different probes in my qPCR work that I am going to do. But I realized that the machine we have in the lab is a Rotor-Gene Q 2plex HRM Platform, saying it has green, yellow,...
01 March 2021 8,544 1 View
I have designed reflectarray element to generate OAM beams at 5.8GHz and feeding it though Horn Antenna on HFSS. After full wave simulation, i am not getting desired results i.e Radiation pattern...
01 March 2021 9,701 5 View
I am currently doing my third year design project. I have been assigned to design a glycerol recovery column in vinyl acetate monomer production. The process unit before the recovery column is an...
01 March 2021 9,525 4 View