Recently, I have been used the RED system to delete the target gene in EPEC. According to the paper, the primer uesd to amplify the selectable marker (cat) is flanked by 50 bp of tir sequence.(Campellone K G, Giese N, Tipper O J, et al. A tyrosine‐phosphorylated 12‐amino‐acid sequence of enteropathogenic Escherichia coli Tir binds the host adaptor protein Nck and is required for Nck localization to actin pedestals[J]. Molecular microbiology, 2002, 43(5): 1227-1241.) Specifically, the primer provided in this paper were:
1. P-tir5'KO ATGCCTATTGGTAACCTTGGTAATAATGTAAATGGCAATCATTTAATTCCGCGGCCGCATGAGACGTTGAT 2. P-tir3'KO TTAAACGAAACGTACTGGTCCCGGCGTTGGTGCGGCATTTACAGAACTTAGCGGCCGCTTTCGAATTTCTGC
Since I have no experience in gene deletion in EPEC, I have some confusion about the design of primers. I thought the sequence of P-tir5'KO should begin with the initiation codon of tir and cat, which were splited by Not1 site ; the reverse sequence of P-tir3'KO should be from the stop codon of tir and cat. However, there are no results when I use these sequences to blast. Therefore, I am very confused. Would someone please give me some help about the design of primer used to delete the targeted genes?
Thanks very much.
Hi Yaun,
Not necessarily. You design primers to amplify fragments constituting missing part of the gene. The hooks of 50 bp each are for anchoring it to the rest of the DNA. In the simplest case,
hook left- fragment left- fragment right-hook right
Length of the hook is determined by the recombination system. Without RED, you need 1 kb on each side of the gene (hook length) plus marker (kan/amp) to select for the right clone. With RED, you need 50 bp on each side of the gene and marker.
For in vitro systems, you will need linear DNA designed as before with the selection marker and typically a exonuclease inhibitor. You can do it by electroporation without RED using 1 kb hooks.
best luck,
Wes
- Badges
- Science topic
- Similar topics
- Mathematical Sciences
- Control Theory
- Control Systems