I have a question about WiscDsLox mutant and WiscDsLoxHs mutant, it seems they are different? i have a WiscDsLoxHs mutant, and i used p745 T-DNA primer to check if the plant is homozygous or not. I have already tried LP+P745 and RP+p745, both pcr did not work. Does anyone have idea or experience to work with WiscDsLoxHs mutant? i will be very appreciate if i can get any suggestions
LB4 primer：TGATCCATGTAGATTTCCCGGACATGAAG
reference:
Dihydroxyacid dehydratase is important for gametophyte development and disruption causes increased susceptibility to salinity stress in Arabidopsis
please try.
I used the LT6 for wiscDsLox, but i can not remember exactly WiscDsLox or WiscDsLoxHs, i will check it tomorrow when i go to lab.
Dear Lilan,
Thanks a lot, I have ordered LB4 primer and waiting for it, then I will try. I am just confused about WiscDsLox mutant and WiscDsLoxHs mutant, seems they used the different vector for T-DNA insertion, WiscDsLox used pDs-Lox, WiscDsLoxHs used pDs-LoxHs. I never found the information about pDs-LoxHs vector.
Thanks a lot again,
and waiting for your further information
best
Xuna
- Badges
- Science topic
- Similar topics
- Biological Science
- Botany
- Plant Biology
- Plant Biotechnology