02 September 2018 4 1K Report

How to calculate the daily solar radiation using temperature maximum and minimum?

More Geetika Sonkar's questions See All
How can u find mean and standard deviation from an FTIR Graph?

The peaks of an FTIR Graph denote the absorbance values .How can you find the mean absorbance value through MATLAB or is there any other way to do do

13 March 2023 3,982 4 View

How to submit gene sequence with gaps to NCBI?

Hi, I have amplified a partial gene sequence of a bacteria with the help of degenerate primers and want to submit it to NCBI, but when I am doing CDS analysis in BLAST getting 74% similarity and...

25 February 2022 3,444 3 View

Why am I getting smear after PCR ?

Hi, I am trying to amplify 190bp a gene promoter from bacteria genomic DNA using following specific primers :[FP: 5’GATCGAATTCGGTAACATTTGTGCCCATAG3’; Tm 59.6] and [RP:...

07 February 2022 3,388 4 View

Is the Bredt's rule applicable to trans decalin?

I am confused on whether decalin system can have double bond at bridgehead carbons or not.

31 May 2021 5,262 3 View

Which matrix is best suited for constructing Maximum Likelihood tree WAG or JTT?

I want to construct a Maximum likelihood tree of gene sequence from isolated species and a full-length sequence of the same gene in other species obtained from Genbank, but I am unable to decide...

25 February 2021 2,479 1 View

What are the methods to automatically annotate a large dataset of images?

Computer vision, Deep learning

22 October 2020 6,251 5 View

How to draw spin density plot from DFT calculations?

Hi, Can Someone please help me regarding how to draw the spin density plots as mentioned in the document attached herewith. How the spin up and spin down densities can be separated? Thanks

21 July 2020 2,586 5 View

What are the different software statistical tools needed to be learnt by an economics researcher?

Various software techniques are floating in the market these days like SPSS, AMOS, ADANCO, SMART - PLS etc, are they required to be known by an economics background researchers? What are the...

23 May 2020 8,254 8 View

Is it possible to develop Electrochemical sensor for COVID-19 ?

Is it possible to develop an electrochemical sensor for COVID-19? Protein sequencing is available on the database. But, can anyone suggest a particular molecule on the surface of COVID-19, which...

22 March 2020 5,595 0 View

How to run chronopotentiometry charge-discharge cycle using AutoLab potentiostat for supercapacitor?

I want to record the charge-discharge (potential vs time) graph for supercapacitor using auto Lab instrument (AUT 302 N). Can anyone suggest step by step, how to feed parameters in the software? I...

11 March 2020 5,549 3 View

Similar questions and discussions
Which type of compound does lamda max of 218 indicate in a uv-vis spectrum of a partially purified compound through column and TLC?

A crude extract of fungal culture using EtOH was subjected to column and TLC and partially purified compound was obtained. UV vis spectrum of the compound/s has max absorbance at 218nm. The...

11 August 2024 9,801 2 View

Stability of the Solar System: Insights from Einstein’s Equations ?

The stability of the Solar System is a complex subject that blends the classical framework of Newtonian mechanics with the modern insights provided by General Relativity (GR). Understanding this...

07 August 2024 2,569 1 View

U you think We need a website software of Blackbody radiation law expert software?

A website software of Blackbody radiation law expert software can used through the following web site. http://39.105.188.151:3000/index

07 August 2024 1,706 0 View

How to use Density Functional Theory to calculate carrier mobilities of solid system?

Hello, everyone. I have tried to determine carrier motilities of some materials, by Density Functional Theory, using Quantum ESPRESSO. There are a few methods to do it, like a package called...

04 August 2024 8,894 1 View

Does continues partial charging/discharging do any harm to the BESS performance and degradation?

For a grid connected BESS (lets say 100 MW/200 MWh system, LFP battery), if we charge the BESS in such a way that whenever we can access power from the solar that will charge the BESS. Hence it...

01 August 2024 9,903 7 View

Best mask design for metal deposition aiming build a Perovskite solar cell device?

What types of mask designs for metal deposition, to be used in a PVD system, are best suited for perovskite-based solar cells?

31 July 2024 4,835 3 View

Can a Conventional 50W visible LED Lamp Emit UV Light?

I'm researching light sources and their UV emissions. I'm curious if a 50W, 7500K conventional LED lamp emits any UV light. I found that a 200W tungsten lamp can emit up to 1.5 mW/cm² at 350 nm....

31 July 2024 3,843 7 View

Which filtration method to go for run off water from dirty solar panels to be used again?

We are working on a robot that cleans solar panels using fresh water supply and a rotating brush. We are trying to conserve as much water at possible by recycling the dirty water that is collected...

28 July 2024 5,778 2 View

How can we calculate the percentage of configuration interaction (CI) in the UV output data of the Gaussian program?

How can we calculate the percentage of configuration interaction (CI) in the UV output data of the Gaussian program? for example: Excited State 17: Singlet-A 5.1359 eV 241.41 nm...

28 July 2024 9,165 2 View

Is it feasible to employ an artificial sun in the experimental investigation of concentrated solar power systems, specifically linear Fresnel systems?

Is it feasible to employ an artificial sun in the experimental investigation of concentrated solar energy systems, specifically linear Fresnel systems? If the answer is affirmative, what type of...

22 July 2024 9,710 6 View

Our partners will collect data and use cookies for ad personalization and measurement. Learn how we and our ad partner Google, collect and use data. Agree & close