Hi,
I need to insert the V5 tag next to a protein into a pBAC, and we want to use the red-mediated recombination to do so. I first need to amplify the kanamycin resistance sequence from pEPkan-S with addition of homologue sequences to our pBAC by PCR. We designed these two primers:
For: gctgttgactttattacctggcgcagacaggagttaaatgggtaagcctatccctaaccctctcctcggtctcgattctacgggtggttctggtggttcttagggataacagggtaatcgattt 124nt Tm: 71.5°C %GC: 48.4% from IDT DNA
Rev: cataccacacagtgtctgcaagataagcatcagccataaaagaaccaccagaaccacccgtagaatcgagaccgaggagagggttagggataggcttaccgccagtgttacaaccaattaacc 123nt Tm: 71.5°C %GC: 48.8% from IDT DNA
The expected size of our amplicon is 1188nt.
We tried the PCR following this protocol:
Template (pEP-kanS): 1 µl (~10 ng)
5X Buffer: 10 µl
dNTP (HF grade): 5 µl of 2mM
Primer Forward: 2.5 µl of 10 pmol/µl
Primer Reverse: 2.5 µl of 10 pmol/µl
NEB Q5 Polymerase: 0.5 µl
H2O (HF grade): 28.5 µl
Total: 50 µl
98°C, 30 s ; (98°C, 30 s; 50°C, 30 s; 72°C, 1.5 min) x 8 cycles ; (94°C, 30 s; 60°C, 30 s; 72°C, 1.5 min) x 22 cycles ; 72°C, 2 min
Up to now, after migration on a 1% agarose gel, I only see the primer dimers on the gel. We are trying to optimize the chosen temperature for the annealing step, but without success. We will also try to do the PCR with 3-9% DMSO to help the annealing of our primers.
I am aware that the primers can easily form dimers, especially because both of them contain the V5 tag, but we have no other option for them. So I was wondering if you could give me advices on which parameters I could optimize for this step. We will try adding some DMSO as I said, and to reduce the quantity of primers used, hoping it will help the annealing to pBAC.
Best regards.
Are you sure that the pEP-kanS is OK - Has it been sequenced?
What about adding the V5 tags as linker oligos after the PCR amplification??
The only other suggestions are to try not to have ATTT (but instead 2 or 3 purines) at the 3'end of the For primer and to start with serial dilutions of pEP-kanS (10ng seems a lot). It might help to linearise that, but I doubt it!
Why 72oC for 2 mins at the end??
I think your protocol isn't a simple way to do what you want. First, I suppose you could do two (or three) PCR, using smaller redisigned primers. The homologous sequence in bold is huge problem.. If you make the second PCR on the first products, you would avoid your primer dimerisation (you can go to 20% DMSO but I don't think it will work). Secondly, you can simply command your desired sequence and attach it to the rest of the gene with a ligase. Third, You can do an in-fusion method (or you can command the entire gene).
I agree with Mathieu.
you could do three PCR, using smaller redesigned primers .
- Badges
- Science topic
- Similar topics
- Biological Science
- Molecular Biology
- Molecular Biological Techniques