This should be relatively simple. 1JJ4 i the PDB has the sequences
>1JJ4:C|PDBID|CHAIN|SEQUENCE
CAACCGAATTCGGTTG
>1JJ4:D|PDBID|CHAIN|SEQUENCE
CAACCGAATTCGGTTG
It's missing the P97 promoter TATA at the 3' end such that I need a model with this sequence as there may be a Proline residue in the C terminus that binds and provides steric hindrance at the P97 promoter.
I've tried using the Build Structure tool without success. Here is the 1JJ4 sequence with the TATA box appended at the 3' end.
>HPV18|E8^E2BS|DNA
CAACCGAATTCGGTTGTATA
Thank you! I may need help with the coordinates for the model.
The coordinates are generated by X3DNA based on the user-provided values of the base-pair and base-step geometrical parameters.
After using X3DNA, the geometry appears off. The Pro353 residue of E2C may interact with the TATA box but the geometry of the appended TATA box to 1JJ4 Chain D is off. How can this be corrected? The tan ribbon contains the appended TATA box.
If there are no experimental structural data from which one could derive proper values of the base-pair and base-step parameters of "TATA," i would set the values of the parameters in "TATA" to their average values in the DNA segment adjacent to "TATA."
- Badges
- Science topic
- Similar topics
- Computer Science and Engineering
- Bioinformatics