It would be very useful to have tame strains of E. coli that are always fluorescent. So far the only ones I can find are from this work: Pinheiro, Bergquist et al. (2008), Applied Microbiology and Biotechnology 77, 1287–1295. In reply to my inquiry, Bergquist says the strains they created now belong to a company called Biomerieux that refuses to share. Is this kind of bug freely available anywhere?
In that case you might want to create the strain yourself either using a transposon, lambda red, conjugation or CRISPR depending how clean you want the insertion to be (certain methods are more difficult with wild type strains like lamda red). A Quicker method if you do not require the intergation would be a stable plasmid to be conjugation to the strain, BACs are good candidate since they carry the stabilization system from F plasmid.
I plan to add this mini gfp like protein sequence with a fusion linker to protein sequences I want to add with CRISPR it is called "miniSOG" and is almost as fluorescent as the GFP which is 8 times larger
minisog w BamHI and fusion linker
CCAATCCTA_GGATCC_CGCGGCGGGCAGCGGCGATGGAGAAATCTTTCGTGATCACAGACCCAAGATTGCCGGACAATCCTATCATCTTCGCAAGCGACGGCTTCCTAGAACTAACAGAGTATTCCAGAGAGGAGATTCTGGGACGTAATGGCAGATTCCTACAAGGTCCCGAAACGGATCAAGCGACCGTTCAGAAAATAAGAGATGCCATAAGGGATCAGAGGGAGATTACAGTTCAGTTAATCAATTACACTAAATCAGGGAAGAAGTTCTGGAATCTATTGCACCTGCAACCCATGCGTGACCAAAAAGGGGAACTGCAGTATTTTATCGGTGTTCAACTTGATGGC
Article A Genetically Encoded Tag for Correlated Light and Electron ...
- Badges
- Science topic
- Similar topics
- Biological Science
- Bioscience
- Biotechnology