Open a text editor:

a.

Microsoft (MS) operating system:

Open Notepad (Wordpad) or other MS compatible text editor.

Save document as plain text (.txt).

Do not save as rich text (.rtf) or as a document (.doc)

b.

Mac operating system:

Open Textedit, TextWrangler or other Mac compatible text editor.

Save document as plain text (.txt).

Do not save as rich text (.rtf) or as a document (.doc).

2.

Create the definition line for your sequence.

3.

Press the “Enter” key to begin a new line following the definition line.

4.

Enter your raw sequence data:

a.

Total sequence size must be at least 200 bp (shorter sequences will not be processed).

b.

Present your sequence data using IUPAC symbols. Any non-IUPAC symbols (including dashes) will be removed from the sequence when it is imported into Sequin. BankIt will not accept sequences with non-IUPAC sumbols

c.

Letter case is ignored, so you may enter the sequence symbols in either upper or lower case. Any significance you attach to the case of the symbols will be lost.

d.

Use the IUPAC approved "N" symbol to represent ambiguous sequence data.

e.

Lines of sequence data in FASTA format should be 80 characters or shorter.

How do I format a FASTA definition line for a nucleotide sequence?

The FASTA definition line must be constructed in the following order and in a single line of text. Do not insert any hard returns (the “Enter” key on your keyboard) in the definition line. In both Sequin and BankIt, the organism and any additional modifiers can be added as tables later in the submission process if you do not include them in the FASTA definition line. The SeqID is the only mandatory component of the FASTA definition line.

1.

Type a carat (">") symbol.

2.

Enter the sequence identifier (SeqID). This SeqID:

Must be unique for each nucleotide sequence

Cannot contain any spaces

Cannot contain brackets

Should be relatively short (preferably under 25 characters). Do not use the complete organism name for the SeqID.

Isolate, strain, clone or other laboratory identifiers are examples of SeqIDs.

3.

Type a space.

4.

Type information about the organism where you obtained the sequence:

This information must be in the format [modifier=text]. For example:

[organism=Gallus gallus]

Do not put spaces around the “=”

5.

At this point you can add additional information to describe the sequence in the form of optional modifiers:

a.

Type a space following the information you entered in step 4.

b.

Enter optional modifiers to describe the sequence:

This information must be in the format [modifier=text]. For example:

[breed=booted bantam]

Do not put spaces around the “=”

6.

At this point, you can add an optional title for your sequence:

a.

Type a space.

b.

Enter an optional descriptive title for your sequence:

Here is an example of a descriptive title for a sequence:

Gallus gallus doublesex and mab-3 related transcription factor 1 (DMRT1)

As GenBank has a preferred format for nucleotide and protein titles, the sequence title you provide will be changed to the proper format by the database staff during processing.

7.

End your definition line by pressing the “Enter” key on your keyboard to insert a hard return.

8.

Here is an example of a completed FASTA nucleotide sequence definition line whose components are the examples used in the steps above:

>SEQ1 [organism=Gallus gallus] [breed=booted bantam] doublesex and mab-3 related transcription factor 1 (DMRT1)

9.

Begin entering your raw sequence data in the accepted FASTA format

Here is an example of how the sequence definition line will look followed by nucleotide sequence:

>SEQ1 [organism=Gallus gallus] [breed=booted bantam] doublesex and mab-3 related transcription factor 1 (DMRT1)

CCGGCGGCGGGCAAGAAGCTGCCGCGTCTGCCCAAGTGTGCCCGCTGCCGCAACCACGGCTACTCCTCGC

CGCTGAAGGGGCACAAGCGGTTCTGCATGTGGCGGGACTGCCAGTGCAAGAAGTGCAGCCTGATCGCCGA…

Remember:

Do not include any hard returns in your FASTA definition line (by hitting the “Enter” button on your keyboard) until the end of the definition line, or you may have trouble importing your FASTA sequences to GenBank.

If you do have trouble importing your sequences, please double check that no returns were added to the FASTA definition line by your editing software.

What kind of information should I include in the definition line of my submission?

Although you can include any information you want in your definition line, the information you do include will be edited during GenBank processing to conform to specific database criteria, and therefore the definition line you provide will probably not remain the same after processing.

See the Sequin help documentation sectionhttp://www.ncbi.nlm.nih.gov/Sequin/QuickGuide/sequin.htm - NucleotidePage on importing nucleotide FASTA for more specifics on formatting a FASTA sequence importation file.

https://www.ncbi.nlm.nih.gov/books/NBK53702/

Yes its possible to bypass the step for WGS submission. I have done the same too. if you can probably share the screenshot of the error, it may be solved.