According to the description on TAIR, the vector inserted in WiscDsLoxHs mutants (Arabidopsis) is pDsLoxHs. However, I cannot find the sequence of this vector, I am asking for help.
Thanks.
Hi,
Perhaps this could be useful:
This vector was used to create the Wisconsin Ds-Lox T-DNA lines. pDS-Lox was constructed using pCambia1300 as the plasmid backbone. The T-DNA region of pCambia1300 was replaced with the T-DNA region from pED204. The resulting plasmid was then modified by installing the Basta resistance gene from pSKI015 in place of the Kanamycin resistance marker found in pED204. Finally, the mutant Lox43 site present in pED204 was converted to a wild-type LoxP site.
If it is vector information you are after.
If you are looking for genotyping primer, this should be a good one for the T-DNA: AACGTCCGCAATGTGTTATTAAGTTGTC
Good luck!
You can check this article: J Plant Res (2007) 120:157–165 DOI 10.1007/s10265-006-0048-x. The WiscDsLox T-DNA collection: an arabidopsis community resource generated by using an improved high-throughput T-DNA sequencing pipeline
There are two T-DNA specific primers you can use (in above article): T-DNA-specific primer LT6 (5'-AATAGCCTTTACTTGAGTTGGCGTAAAAG);
T-DNA-specific primer p745 (5'-AACGTCCGCAATGTGTTATTAAGTTGTC).
- Badges
- Science topic
- Similar topics
- Vectorization