Could you please send me email to send you abstract and paper?

More Khawar Sultana's questions See All

If Concentration of DNA is 85ng/ul then calculate its concentration for 50ul reaction using Phusion Flash Master Mix?

can any budy explain how i calculate the DNA concentration for the 50ul reaction?

22 May 2024 9,557 1 View

If the sequence of the primers are given and size of the PCR product is 2500 then what will be the PCR profile for the given reaction?

If the sequence of the primers are given as: Forward: ATATAGACCAATATTCCTGTTAGCA, Reverse: AAAAATTAGCCGGGCGTAGTGGCG and size of the PCR product is 2500bp, then what will be the PCR profile for the...

22 May 2024 7,777 1 View

How to generate electron density map in GSAS II software?

I would like to learn the procedure for generating an electron density map using the GSAS II software. I previously saw suggestions, but I am unable to execute them. I would really appreciate any...

17 March 2024 4,555 2 View

Reference mapping and de novo algorithm for genome assembly?

Hello, I am working on viral metagenomics and have started using the High Throughput Sequencing reads for virus genome assembly. Since, I am at the beginner level, I have some confusions. As these...

01 February 2024 296 1 View

Can anyone tell me the procedure of dissolving SnO2 into hot aqueous solution of hydrochloric acid?

I want to dissolve SnO2. But as it is not soluble in water, I need to add this in hot aqueous solution of strong acid. For that, I need to know the temperature and time parameter required for...

27 January 2024 1,232 0 View

Site Response Analysis by PLAXIS 2D and 3D?

Does anyone know how to plot Depth Vs PGA graph in PLAXIS 2D and 3D?

15 January 2024 2,224 0 View

Can I publish my research paper here ? what are the guidelines ?

10 December 2023 1,167 3 View

How can we determine final concentration from calibration curve for same concentration for kinetic studies?

We have to find equilibrium concentration from calibration curve for same concentration for effect of contact time and kinetic studies using uv vis. There won't be any slope for just one initial...

20 October 2023 909 0 View

Can adsorption isotherm be calculated from 3 initial concentration for heavy metal removal?

We have taken 10 g/l, 5 g/l and 2.5 g/l as initial concentration. And calculated concentration equilibrium from absorbance uv-vis spectrometer. So 3 concentration will be enough for adsorption...

16 October 2023 5,725 2 View

Which adsorption isotherm would fit more?

The values of the correlation coefficient of biosorbent estimated for langmuir and freundlich isotherm were both high 0.99908 and 0.99994 accordingly. But 1/n value were not between 0 to 1 for...

16 October 2023 1,075 3 View

Is this website real?

Is this website real? https://isar.org.in/event/registration.php?id=2434532

08 August 2024 484 1 View

U you think We need a website software of Blackbody radiation law expert software?

A website software of Blackbody radiation law expert software can used through the following web site. http://39.105.188.151:3000/index

07 August 2024 1,706 0 View

Gromacs first step of minimization ?

I have face this problem anyone help me how to solve this issue ?which is below Fatal error: There are inconsistent shifts over periodic boundaries in a molecule type consisting of 78 atoms. The...

07 August 2024 2,598 1 View

Is it legal to upload a graphical abstract previously published on your paper's first page to a website such as figshare.com under CC-BY-4.0 license?

Dear friends, does anybody know that is it legal to upload a graphical abstract previously published on your paper's first page to a website such as figshare.com under CC-BY-4.0 license? Thanks.

05 August 2024 7,098 3 View

How can I find access to heavy metal reference doses from the EPA and WHO websites?

Reference dose and Maximum acceptable concentrations HMs

03 August 2024 8,230 4 View

Can anyone provide me with molecular docking softwares/ websites?

Molecular docking software/ websites?

02 August 2024 8,704 7 View

Pls send me IEEE conference paper template if anyone have?

IEEE Conference template

02 August 2024 8,762 2 View

How to find projects for a team of professional developers in AI?

We are looking for projects for a team of professional developers About us We are a team of experienced developers with over 10 years of experience in various programming fields. Our mission is to...

30 July 2024 8,377 0 View

How to change the version of the article full-text pdf file?

How to change the displayed full article text to its corrected version? In the file on the page of the journal where I published the article, there was an error in the text, the table is...

30 July 2024 3,229 2 View

Do you know of any online international conferences that offer free discussions?

Do you know of any online international conferences that offer free discussions? I am looking for examples in the field of molecular ecology and DIY biology.

28 July 2024 6,501 0 View

Christine Elizabeth Welch

Your abstract and paper can be submitted at the following URL: ecis2018.eu/submissions

Peter M. Bednar

The submission system will be open in October. Information about the conference and the important dates are on the conference website: www.ecis2018.eu

Khawar Sultana

Thanks