Dear all,
I've successfully used gRNA's that target the top DNA strand, but now I'd like to use a gRNA that targets the bottom strand. I just wanted to confirm that my cloning strategy is correct when putting in gRNAs that target the bottom strand into the pSp-2A-Puro vector. The sequence of the gRNA as given to me using the CRISPR design tool is GCGATTCTGACCGGGTTGGC TGG , which targets the bottom strand. Is my top oligo still the sequence the design tool gives me, and the bottom oligo the reverse complement (which is actually the top strand)? And would I clone that in the same way as I would a gRNA that targets the top strand? Basically I want to know if I need to do anything different or if it's all the same!
Thanks in advance
Dear Bastian,
it doesn't matter on which strand your guides are sitting. You can just use them as given by the software and clone them into the vector! It's only important that the sequences are always 5'-3', the strand is not important!
don't forget to phosphorylate- easiest is to order oligos with the phosphate already on them
We simply add a T7 transcription site to the 5' end of our guide RNAs. After fusing with a generic complementary oligonucleotide, you can transcribe your guide RNA from this double stranded fusion product and skip all of that cloning.
https://www.neb.com/applications/genome-editing/in-vitro-transcription-of-sgrna
The Wt Cas9 protein will introduce a double-strand break guided by the sgRNA you generated, so it doesn't matter which strand your sgRNA actually binds to. In certain cases, for example, when you want to introduce paired nicks and/or when you design ssDNA HDR, then the specific strand you target can matter.
It is important to remember that each target selected by CRISPR design tool is orientation- and strand-specific, cause of the PAM sequence. So if I understand your question correctly, there is only one guide sequence you can clone into pX vector for each target site selected, and it will be no such issue as reverse complement of the chosen target sequence. If you wish to target a specific strand, you will need to find a target site that allows you to do so.
After reading your question again, the answer to your question is you don't need to do anything different, just use the sequence in front of the PAM site. No reverse complement necessary.
- Badges
- Science topic
- Similar topics
- Geoscience
- Asia
- India