rs2231142 has a sequence of

CACTCTGACGGTGAGAGAAAACTTA[A/C/G]AGTTCTCAGCAGCTCTTCGGCTTGC

and alleles of c or g or A so the MSE1 cut site of TTAA only exists for one of the 3 alleles and will not distinguish between the C and G alleles.

rs628031 also has alleles of A, C or G so in its sequence

CGTGGGCCGCATCTACCCCATGGCC[A/C/G]TGTCAAATTTGTTGGCGGGGGCAGC

Mse1 cuts TTAA and this sequence does not exist for any allele of rs628031 so the enzyme does not cut this sequence at all so is not useful

Following