I have a large vector (~10kb) and I'm trying to trim it down to just the parts I need (~4kb) while adding 5'/3' linkers (~20b each). My plan was to make primers ~60 b long, where 40 of those bases are the backbone and the remaining 20 contain the linker. I've used this method before and it worked but I had more funding to use more reagents. I'm limited in what I can purchase so designing new primers or order more polymerase is a last resort.
Here are my primers:
F: GAACGTGGCGAGAAAGGAAGGGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAA
R: CGCCGGCTTTCCCCGTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACT
The GC content is ~50% and they don't seem to form any primer dimers of particular significance. When I run the gel you can see them amplified at the bottom of the gel. My primers are 0.5 µM. The Annealing temperature suggested by the NEB calculator was 72 C, which is also the elongation step temp.
What are my options? If I do a gradient, how far should I step? I'm using Q5 polymerase.
Why do you need 40 bases of backbone? Around 18-20 should be enough for proper annealing... that should result in shorter primers and lower the Tm (in your pic the suggested Tm is 85 and 86 degrees). The reason NEB calc suggests 72 degrees is that that is the optimal extension temp for Q5 and if you raise the annealing/extentsion temp above that, you won't get much amplification.
Ive done it with Phusion before and it worked. My linkers are quite long so I wanted to make sure there would be enough of the template backbone so it would recognize the plasmid instead of being half un complementary (with the tags). I may have to just order new primers . Do you think changing any of the concentrations would help ?
It is hard to guess whether you may succeed since there are many parameters affecting a PCR.
For calculating the Tm you should keep in mind that the 40 of 60 nucleotides anneal with your template. Then, I don't like the upper oligo. 5A+Ts at the end is not the best design. In addition, the upper sequence shows that you have designed an oligo with a repeat (GCAAAAGG) which I would try to avoid.
Is there no chance to trim down the vector restriction enzyme or request a smaller vector from colleagues?
I don't have an ultimate answer just suggestion. First of all - I think your primers are simply too long and they would prefere each other especially in higher concentration. Second - If 10uM is your final concentration it's too much (I guess you just mistyped concentration). How much template DNA? Keep it down because PCR is powerfull and it amplifies from schratch. Third - I don't have experience with Q5 but Phusion is very accurate polymerase and it amplifies long products easily. Classical Taq Polymerases are many times limited in product size however you should have at least some product. You did not specify for which purpose you need this special piece of vector (so why bother with this one) and how perfect should be your PCR product. So my recommendation is to keep down primer and template DNA concentration (it might be final 0.1uM easily and a few pg of plasmid DNA, of course you can run more samples to play with concentration) and run it at 72 (Tm of your matching sequence is far beyond that temperature so use optimum for your Q5). The second suggestion is to try adapter PCR to avoid mismatches in your PCR products if needed (first with long primers and then use PCR product as a tempate for 2ns PCR with your 20bp adaptors only).
@Uwe That is my plan, I found some restriction sites that I could use to chop up my vector. I don't have much left so I would need to do some preps to make more. Accounting for just the 40 b binding, the annealing temp is still 72.
@
- Badges
- Science method