forward primer-5'-TTC GGG GTG TAG CGG TCG TC-3'
reverse primer-5'-GCC CCA ATA CTA AAT CAG GAC G-3'
These are the primers for the methylated allele of the gene GSTP1 taken from 'Prostate cancer detection by GSTP1 methylation analysis of postbiopsy urine specimens (Mark L. et al. 2003)'.
Can anyone please tell me the Methylation specific PCR product length of these primers?
The methylated and unmethylated product will be about the same size - the primers are just different sequence to detect the shift from C to T in the unmethylated sample. This is the methylated sequence so it will not be modified by bisulphite so will be the same as the genomic sequence in the database. You can do an in silico PCR at UCSC or NCBI to check the fragment pulled out.
It varies, but 22 is an optimal length, check the attached articles and reference link for more:
Primer Design Rules for Methylation Mapping Experiments
Bisulfite sequencing PCR (BSP) or restriction PCR.
Primers should not contain CpG sites within their sequence to ensure unbiased amplification of both methylated or unmethylated DNA. Primers should have an adequate number of no-CpG 'C's in their sequence to amplify only the bisulfite modified DNA. Primers with more no-CpG 'C's will be preferred.
If CpG island prediction is not used for primer selection (default), PCR products must span a minimum number of CpG sites specified by the user (default: 5).
Methylation-Specific PCR (MSP)
Primers should contain at least one CpG site within their sequence, and the CpG site should preferably be located in the very 3’-end of their sequence to discriminate maximally methylated DNA against unmethylated DNA.
Primers should have an adequate number of no-CpG 'C's in their sequence to amplify only the bisulfite modified DNA. Primers with more no-CpG 'C's will be preferred
Primers for methylated DNA (M pair) and for unmethylated DNA (U pair) should contain the same CpG sites within their sequence. For example, a forward primer in the M pair has this sequence: ATTAGTTTCGTTTAAGGTTCGA, the forward primer in the U pair must also contain the two CpG sites, e.g., ATTAGTTTTGTTTAAGGTTTGA. But they may differ in length and start position.
The M pair and U pair should preferably have a similar annealing temperature.
CpG island predication and primer design
If CpG island prediction is used for primer design and more than one island is found, any of the predicted islands can be a target region for primer selection.
If a CpG island size is smaller than the minimum product size, the primer pair should span the whole island.
If a CpG island size is greater than the maximum product size, the primer pair should be within the island.
If a CpG island size is between the minimum and maximum product size, at least two thirds of the island region should be amplified
Reference: http://www.urogene.org/methprimer/rules.html
Good luck, Saba
thank you for your reply......there are soft-wares to find out the product length of these types of primers e.g. methyl express,...its paid and not available in my institute...if anybody can give me that software it will be very helpful to solve such kind of queries
there is a free online tool for this just google bisearch.
the primers you mention however don't show a product, as the second primer does not allign anywhere on the bisulfite converted genome. (I must note though, this primer also doesn't make any sense to me, as it contains G's outside of CpG's which shouldn't work as far as I can tell)
- Badges
- Science topic
- Similar topics
- Biological Science
- Molecular Cell Biology