I'm not sure exactly what you're asking. Cas9 cleaves the DNA 3bp upstream of the PAM so an sgRNA targeting the sequence CGTAAGCTAGCTGTCGAATCCGG, would cut like this.... CGTAAGCTAGCTGTCGA   X   ATCCGG

sgRNA is a merged form of a naturally occuring crNA and trancrRNA. The cas9 mediates the cleavage of based on complemenatarity between the crRNA (sgRNA) and the target DNA. So based on the target sequence sgRNA can be designed to cleave a specific sequence in the genome. 

Thanks bro but i want to know whether it has been proved that is there any specific position which can be determining factor as for example in case of siRNA ,the position is around 9,10,11 where the activity is maximum and are able to control it ,automatically reduces the activity. I wanted to know is there any specific position ,if it is please enlighten me 

I'm not sure exactly what you're asking. Cas9 cleaves the DNA 3bp upstream of the PAM so an sgRNA targeting the sequence CGTAAGCTAGCTGTCGAATCCGG, would cut like this.... CGTAAGCTAGCTGTCGA   X   ATCCGG

Thanks man ,but the problem is any of the recent papers the exact position is not mentioned ,it doesnt matter to me how it cuts right now ,but where it cuts.

Thanks Benjamin for input it would help me in future 

Dr. Housden, is there any paper that you can direct for this particular aspect of Cas9? And does all the Cas9 enzymes (from different species) cut 3 bp upstream of PAM?  

Different Cas9 enzymes cleave in different places. Have a look at this methods book that just came out. Multiple chapters refer to the cutting position and there are links to the original papers.

Methods in Enzymology

Volume 546, Pages 2-549 (2014)

The Use of CRISPR/Cas9, ZFNs, and TALENs in Generating Site-Specific Genome Alterations

Edited by Jennifer A. Doudna and Erik J. Sontheimer

Thanks its really helpful