4 kb is very long for reverse transcription and I doubt if you have very much full length product. If you have any full length product I would try nested pcr to generate visible amounts of product otherwise amplify smaller lengths and ligate or overlap pcr to generate full length product

Dear Paul, I have read from the M-MLV data sheet that it is suitable for up to 7Kb strand...!!! 

How can I get a full lenght cDNA from RNA? I am using now random primers that they should help the enzyme to reverse transcribe the RNA as they are randomly located...

Once I have the full length cDNA I could overcome this problem by using two couples of primers for example...one couple bringing my desired sequences for the restriction enzyme at the 5' and 3' and another couple just in the middle of the DNA!! Could be an idea...

I have not properly understood what you are suggesting to do, sorry!!

You can run several PCRs and ligate/subclone as Paul suggests. Another possibility is to focus on reverse transcription first: use oligo dT primer for RT. Whether reverse transcription of your gene of interest was full length can be easily determined by running PCR designed to amplify 5´end of given cDNA. If not, you can run set of RT reactions using gene specific primers to cover full length mRNA. then, you can run PCRs for subcloning/ligation.

Q5 polymerase is a good one, however 4 kb is a long amplicon even for it (even if much longer amplicons are nicely shown in the catalogue).

yes I have occasionally thought that the excellent results making up commercial literature are carefully selected ideal situations rather than completely typical!.

However What I was suggesting was specific transcription either with poly T  or specific oligos. Ideally one of these might give tiny amounts of cdna which could be amplified then the probably invisibly small amount  of full length first pcr amplification product could be re amplified with nested primers whose 3' end lies a few bases inside the first amplification primers to get a reasonable amount of product. If that failed then i was thinking that 3 second amplifications with internal primers could generate pcr product which could all be ligated to give your full length product.hopefully I have made this a little clearer. good luck

paul

Dear Martin and Paul thank you for your suggestions. So, I am thinking to focus on the Reverse Transcription firstly. 

I seem to understand that one of the suggestion is to make a new Reverse Transcription with specific oligo dt in order to be sure that I have cDNA and try to make a PCR of this product with my specific primers, bringing my specific sequence I need, and then make a second amplification with another pair? Is this the nest PCR, right? two reaction with two different pairs of primers or use the two pairs in the same reaction? I am not expert of this area so I am asking to you.

Can you please link me somethings where I can study this type of PCR? 

Do I need to design specific oligo dt for the RT reaction?

Thank you

Dear Paul a doubt; which is better to use in terms of primers for long mRNA, oligo dt primers or random primers? I was just reading that using of oligo-dt for  Reverse Trascriptase you could risk that the RT will not be able to cover the full length of the cDNA, problem that should be overcome with the use of random primers. I am a bit confusing as I used for my reverse transcriptase random primers. 

Maybe in my case the problem is not the RT but the PCR amplification, and for this last case I should use, as you suggested, two pairs of primers....

Can I assume at least that I managed to get a cDNA by using random primers?

Hi Gianmichele,

4kb amplificatioin is quite long but doable. I remember amplifying the full genome about 10kb of Potato virus Y (a potato-infecting virus) in one RT-PCR. This only happened once. The reverse primer should be the best choice for RT, followed by oligo dt. I wouldn't recommend random primer. use a good polymerase/kit for PCR; preferably a high fidelity DNA polymerase. Phusion was the high fidelity pol i knew when i amplified the 10kb.

All the best it's possible.

Hi Gianmichelle,

I would prefer oligo dT primer or gene specific primer over random hexamers. For cloning purposes, result is expected to be more accurate.

OligodT primer is a primer targeted to polyA tail of mRNA. Typically it consists of 16-18 Ts. In this case, RT will start from poly A tail (3´end) and will proceed towards 5´end (ideally to the first base) of the transcript. If the transcript is too large (or complicated - eg high CG or full of hairpins), RT may not be able to read through. To see, whether RT was complete, design "diagnostic" primers at the 5´end (sense primer sitting at the far 5´end, the other just a bit more downstream - eg 100 bp). Then you can run PCR with a bit of your new cDNA as a template - if you get the product - you can be sure, your RT was fulllength. If yes, proceed to amplification.

If not, you need to work a bit more on it. You can design more "diagnostic" sets of primers, throughout your transcript - by running series of PCRs, you should be able to say, to what extent your RT proceeded.  If eg only a half has been amplified, run another RT with gene specific primer (instead of oligo dT), that anneals somewhere in the middle of the transcript. Check, whether this RT reached 5´end (using diagnostic primers) - if yes, proceed to amplification, if not, design another gene specific primer (closer to 5´end) and run another RT... 

Amplification of the product:

if you have the full length cDNA from the initial reaction, just run PCR with gene specific primers, that anneal to the far 5´and 3´ends.

if you have a series of cDNAs (covering the whole transcript), amplify them using gene specific primers and subclone.

Sometimes (and I guess this would be the case), you have full length cDNA (as confirmed by PCR with "diagnostic" primers), however you do not have sufficient PCR yield. Here using two or more overlaping PCRs followed with subcloning should be used. The great advantage here is that you do not need to run several RTs.

Martin thank you so much for your response. So, I will follow your suggestion:

The first thing I will do is to make a new RT with oligo dt primers; I will design two diagnostic primers  for my cDNA at the 5'. I hope to get the the full length of cDNA, so then I will make the amplification with specific primers at the 5' and 3'end.

When you said, if the full length is obtained, designed a sets of primers throughout my transcript, you mean that I have to run several PCR by using a set of primer for reaction, run a gel, purify the product and once covered all the length make a ligation (e.g. 1st reaction with a first set of primer: primer forward that set to the 5' and  primer reverse: 200bp downstream ; 2th reaction forward sit to the 201bp reverse 400bp, and so on. It's a like a sequencing? Did I well understand?

Amplification:

When you said if you have a series of cDNA, did you refer to the case that I have above commented, e.g. several short PCR products?

Last thing: when you said overlapping PCR what do you mean?

At a moment I will start with the RT by using oligo dt and I will check the length.

Thank you so much Martin very helpful 

Gianmichele

I forgot to say you Martin that my gene of interest is 54% GC reach.

I attached the word file of the sequence and the forward and revers primer I designed bringing my specific sequence for the restriction enzyme just in case you want to have a look.

Thank you so much 

Other thing I thought is: can I start from total RNA to make the RT or it' better to start from mRNA? I am using for the mRNA extraction the Nucleospin Total RNA kit.

 Martin the RT master mix will be the same I used with random primers, with the difference of oligo dt isted of random primers? The final concentration of oligo dt? A good company from which o buy the oligo dt?

Thanks a lot

Yes, you can start from total RNA (mRNA would be better, but not significantly) - if you have total RNA, use it.

The master mix should be the same as with random hex ( use 100 pmol of oligo dT per 20 ul reaction instead hex). The only difference would be RT incubation - for oligo dT or gene specific primers higher incubations are recommended (42°C - random hex typically anneal at 25°C). Give your RT enough time to complete full length rev transcription - eg 60 min (much shorter period is usually used for hexamers).

You can get yout oligo dT at your preferred supplier of primers/enzymer for RT. Every company involved sells it.

 Once finished the RT recation have I to treat the solution with the RNase H to delete the RNA strand? I am thinking to use the Protoscript First strand cDNA synthesis kit from New englan biolab that comes with the M-MuLV enzyme and an oligo dt mix and a random primer mix solution, so you can decide if use only oligo dt or a mix of oligo dt and random primers. i think that the second option of mixing both could be more helpful.... Just an idea.

Gm

Martin last question promise: I can design diagnostic primers as normally, just complementary primers of the cDNA right of 12-20 bp length starting from the 5' of cDNA product of RT....

Thank you for everything

Design diagnostic primers as for other applications - one complementary, the other anticomplementary. Left primer should anneal to expected 5´end. Short PCR product is sufficient (but can be longer if necessary - eg due to complicated underlying sequence). This primer pair is just to prove, you have full length cDNA (if you get PCR product in this PCR, you have full length cDNA - make sure, your RNA/cDNA is not contaminated with DNA). If not, you can design another primer pair located colser to the 3´end to see, where the RT actually stopped working. 

Treatment with RNAse H is not necessary - heteroduplex will dissociate during denaturation step in PCR. But if you treat it with RNAseH, no problem, even better.

Do not mix random hex with oligo dT - in this case, you wont be able to decide, whether you have full length cDNA (you will get positive diagnostic PCR even if you do not have full length cDNA - hex can start near to the 5´end). On top of that, random hexes need lower annealing temperature  - this increases the chance, your RNA will retain its possible hairpins, preventing RT. Use oligo dT or gene specific primer and try to keep RT temperature high.

Hope it helps.

One more thing - if your transcript is not abundant, you can purify/concentrate it using oligo dT beads. That will purify just mRNA out of your total RNA. Then, you can run RT directly on your beads - your cDNA will be bound to beads, so you can easily wash it and use washed beads as a template for subsequent PCRs. 

I did have similar problem, and my problem was that the level of the transcript was really low.

You can use DNA to do the PCR, if there is introns you can built your sequence using the Gibson assembly system (or another one).

Don't forget you can only receive a transcript if there is one.

Have a good luck 

Thank you so much Martin. 

Oh my God a doubt:  Starting from the cDNA obtained with RT, assuming I want to amplify the first 121bp of my cDNA close to the 5' , I have to design just one pair of primers, right?,  one fitting at the beginning and the other one is the complementary at the 3', it's correct?

     5'  ...................

1  atgacagcagacaaa ttggttttctttgtg aatggcagaa aggtggtgga gaaaaatgca

    tactgt cgtctgttt   (Reverse primer, 3' to 5')

61gatccagaga caaccctttt ggcctacctg agaagaaagt tggggctgag tggaaccaag

                                                                                                  .........................3'                  

121 ctcggctgtg gagaggggggctgcggggcttgcacagtgatgctctcc aagtatgatcgt

        ...................................................................................ttc atactagca 

                                                                     (Forward Primer 5' to 3')

Sorry Martin, can you please confirm my primers?

I assume they are ok, but just to double check!!!!!!!!!

Thank you

Dear Gianmichelle,

I am afraid, your primers are not correct. I assume, the first ATG is the initiation codon, coding first methionine (if not, ignore most of my comments). If so, complementary primers should be designed. Check attached file  - I put there an example, how DNA is processed into RNA and cDNA (I had to put it as an attachment to keep formatting, that makes it more clear). 

Additionally, your primers seem to be quite short (with low melting temp) and without GC clamp - I always prefer GC clamp in my primers (but this is just an unimportant detail). In the file, I have included an output from Primer3 software, I used to design primer pair, that should be ok for your application (highlighted) - even, if the melting temp is slill a bit low..

I am not sure, if you need just coding region or full length cDNA to be cloned. Keep in mind, that there is 5´UTR upstream. 

Thank you so much martin. Very useful. You are right, the sequence above was wrong as I considered the cDNA, but to design primer you have to consider the complementary of mRNA.

I would need the entire coding sequence of my cDNA.

I know that the 5' UTR region is important in the regulation of translation. I have seen that in my case the UTR region is 79bp upstream, so I can really consider to include it. 

Dear Martin I made a new Reverse transcriptase of total RNA extraced from several cells using a Protoscript first strand cDNA synthesi based on the oligo d(t)23...!!! I made then a PCR amplification with the diagnostic primers that you suggested me, running in the same gel also a positive control (the same cDNA samples with beta actin, and one negativce CTRL). In the presence of diagnostic primers I didn't get any band, whereas with beta actin a very very low signal band....!!!!!!! I want to say that for the beta actin control I loaded 10ng, whereas for the diagnostic primers reactions I loaded two different concentrations, 10ng and 500ng!!!!!!!!  Which could be the problem??? My colleague with her cDNA (I am using as well) and her primers got a big signal whereas in my gel the signal was so so low..........!!!!!!!!!!! Suggestions?

Dear Gianmichele,

provided your diagnostic primers are ok (i guess so), problem must be in RT. It can be complicated structure of given RNA (hairpins etc) or inhibitors/suboptimal reaction conditions during RT. If the troubles are seen not only in your target, but also in beta actin, I would vote for the later possibility. 

by the way - how many sets of diagnostic primers did you use (and what was their distance from polyA tail?)

Dear martin I have just used one set of diagnostic primer at the 5 end. I have run another gel today, with the same primers that might bright my RE sequence and once again  I didn't get any band. I made a RT with the first strand oligo d(T) from New England biolab, and for the PCR amplification the HOTStarTAq polymarase of Qiagen but nothing. I checked the quality of my DNA with a couple of primers for beta actin and this time beta actin was fine. What else? attached the last gel imagine. 

Dear Gianmichele, 

seems, the problem is in the template (secondary structure, etc), as RT works for b actin. You can try more sets of diagnostic primers (apart from those at 5 end, you can design a pair somewhere in the middle and near 3 end). This might help you to estimate, where RT actually stops - I guess, your RT runs from poly A tail and the polymerase hits a hairpin.

Possible solutions: Run your RT in several independent reactions with different specific primers - the first would be oligo-dT (alternatively, you can add few  specific bases), the second primer should recognize your mRNA a bit further etc. Spacing between primers depends on the RNA structure, the more complicated, the shorter cDNA is created - the more primers you need (I would start with 1000 bp spacing). From your c DNAs, you can get several PCR products for subcloning.

Privided you use specific primers, try to use RT polymerase, that works at higher temperature - this should minimize the risk of hairpin formation. This can be tyour starting point - add few bases to your oligo dT primer to increase its melting temp and run specific RT with higher temp polymerase and you will see.

If your target is not abundant, you may need to concentrate mRNA a bit - purify it using oligo dT covered beads or cellulose. By doing this, you can get rid of rRNA and all such stuff, which "dilutes" your mRNA. Further RT can be done directly on the beads.

Martin

Dear Martin, so:

1)  I used specific primers not for RT but for PCR amplification. 

2) I have already used oligo dt for the RT, but it didn't work. So, yes one possibility could be to move on the specific primers for the RT. How many specific primers do I need for the Reverse transcription?

3) In the last RT, using the oligo dt, I used the HotStarTaq polymerase from Qiagen, that needed an initial heat activation at 95C for 15'; don't you think is this temperature enough to reduce the hairpin formation?

4) so, do you think that the problem is the RNA, right? You think it is only partially reverse transcribed? 

I can attach the western blotting where I loaded proteins obtained from this cell line, and you can see that the protein it's highly expressed. So, I can suppose that also the gene should be greatly present. (Gel on the right, last well)

Yes, what I was talking about previously is specific primers for RT. Typically, you need a bit less specific primers when compared to oligo dT. For 20ul RT reaction, 20 pmoles of specific primer should be ok. 

ad 3) Hot start Taq is for PCR amplification of your cDNA. You need to increase temperature during RT, as hairpin is problem on mRNA level. RTs are typicaly working at 37°C, some prefer 42°C, but there are RTs, that work well even at 50°C (and can remain active up to 60°C). If you design primers with higher annealing temperature, you can increase reaction temperature significantly. You can also mix the reaction in two steps A) water, template, primers - heat it do cca 65°C for 5 min, chill on ice and add the remaining components of your RT mix and incubate 1 hr at optimal temperature for your enzyme (the higher, the better).

If you are not sure, whether your primers would stick to the template at elevated temperature, you can incubate the mixture at 37°C for a while (5 min) and then raise it to the desired temperature. The incubation at lower temp enables a short extension of your primer (this increases its Tm), the second incubation (at higher temp) should destroy hairpins and enable succesfull RT.

ad4) Yes, it seems, problem is mRNA level (if RT process is wrong, you should not see b actin)-incomplete transcription. Where exactly rev transcription stops is not clear - several diagnostic primer pairs would help.

Based on WB, it seems, your transcript should be abundant, but not for sure. Protein and mRNA levels do not always correlate. qRT PCR is much more reliable.