I'm using Kraken2 to generate a custom database to run a shotgun metagenomics (microbiome) dataset against for associated host removal (the custom database is the host). The database builds fine, but the "--unclassifed-out" .fastq files have "x"s added to them (perhaps instead of Ns) and this is not readable in my downstream applications with qiita/qiime2. Why is this happening? I can't figure it out. Interestingly, I have done this procedure before and have not had this problem. Any thoughts as to what is going on? The output in my text editor looks like this (note the "x"s in the sequence):
FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF,,F:,::,,,:,FF,,:,,::FF,FF,FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF
@A00223:522:HW3NCDSXY:1:1101:8992:1000 1:N:0:GTGCACGA+GCCTATCA
AGTGCACCTCAACCCTATGTATTGTGGACCTATACCAGTCCTTATAGAATGGCAGACTGTACCTCACTCAAxCCTATGTACxGAGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTGCACGAATCTCGxxTxxCxTCxTxTxxTTxxA
Convert the fastq to fasta and replace x with Ns.
You can try this for the purpose
https://github.com/abhijeetsingh1704/DNAcleaner
Thanks for the reply Abhijeet. Unfortunately, this will remove the quality information...and also leaves unanswered why Kraken2 is doing this in the first place (it should not).
It does not work for my needs as I am not able to retain quality scores. DNAcleaner only works with fasta files. Needing to convert fastq to fasta loses all quality information needed for additional processing.
No, what I mean was how does your fastq files look?
Do they also have Xs?
If this is your file problem or Kraken problem. In case of latter, maybe getting help from kraken2 dev is needed.
Yes, the x's appear in the fastq files after a kraken2 operation (but not in the original files). I believe this to be Kraken2 problem and have posted on their Issue page here: https://github.com/DerrickWood/kraken2/issues/647
This can help you
awk '/@/{ n=NR+1 } NR==n{ gsub(/x/, "N") }1' input.fq > output.fq
- Badges
- Science topic
- Similar topics
- Chemistry
- Pharmacology
- Pharmaceuticals
- Drugs