Thanks to all who joined the discussion of useful COI primers for shark DNA amplification. I have narrowed down our efforts to the Ward et al. 2005 primers, but there are 2 sets, 2 forward and two reverse, we would like to narrow down the search to which set is likely to perform best, and specifically with Odontaspis noronhai, the primers listed are:
FishF1-5TCAACCAACCACAAAGACATTGGCAC3,
FishF2-5TCGACTAATCATAAAGATATCGGCAC3,
FishR1-5TAGACTTCTGGGTGGCCAAAGAATCA3,
FishR2-5ACTTCAGGGTGACCGAAGAATCAGAA3
(PDF) DNA Barcoding Australia's fish species. Available from: https://www.researchgate.net/publication/7550627_DNA_Barcoding_Australia's_fish_species [accessed Jul 01 2021].
Has anyone used these with Odontaspis, or even Odontaspidae? Thanks again.
Dear Ali,
I have not specifically tested these species but COI-3 primer cocktail from Ivanova et al (2007) worked in my hands in all Mediterranean species
Regards
Andrey
Brenden S Holland I have used all primers from Ward et al. 2005 and Ivanova et al 2007 in a few shark species. The primers from both papers bind to approximately the same COI region, so you get the same segment (the barcoding region). You can do a mix with all and try in your samples.
There is no reference mtDNA for O. noronhai and just a few partial sequences. You can try to align the primers to a related species - the mtDNA of Odontaspis ferox is available. You can align the primers and see if they are close enough, and have an idea if they are likely to amplify.
I had some deep-sea shark species that fail to amplify with all Ward and Ivanova primers, so be careful. You may have to design new primers. If that is necessary, look to related species with available mtDNAs.