3 Questions 2 Answers 0 Followers
Questions related from Fahmida Anika Khan
The primer sequence is Forward: GGAAGCTTTAGCAAAATCCAGTGTGGTGTA Reverse: AAGGTACCCAAGCTCAATCTAACAATGCAG
01 February 2024 7,123 0 View
I have about two months old plate culture of Macrophomina phaseolina. There is no contamination in the plate, but the culture has become wet. I tried to prepare new plates from that culture, but...
10 May 2023 5,848 0 View
I have collected samples from ponds and lakes of Dhaka City.
08 November 2022 8,003 2 View