What are the main factors to become a reviewer of journal in Computer Science?

More Khawar Islam's questions See All

Has anyone applied Python in the field of textile engineering for data analysis, automation, or smart textiles?

I'm currently exploring the application of Python in textile engineering, specifically in areas like data analysis, process automation, and the development of smart textiles. I'm interested in...

10 August 2024 7,429 2 View

How to use ERP System in Global University ?

27 July 2024 8,229 0 View

How can I prepare the csv. dataset to find the flood triggaring factor using ANN?

here's a concise guide for preparing your CSV dataset in Excel to identify flood-triggering factors using an ANN: Clean and Format:Address missing values (fill with mean/median or remove if...

21 June 2024 7,941 0 View

How do integrate ECG, PCG, and clinical data to apply early fusion multimodal?

how do integrate ECG, PCG, and clinical data to apply early fusion multimodal?

10 June 2024 3,289 1 View

How can I make complex file of ligand (including flexible residues from protein) with protein Structure after AutodockFR docking?

I have performed the Molecular Docking using ADFR suite, I have obtained the files in _out.pdbqt format for ligand docked poses, upon inspection, both visually and reading the pdbqt files of...

08 June 2024 8,130 2 View

Could anyone suggest me which filter paper would be best for filtration process?

Dear Respected Scholars, I am working on detection of microplastic in prawn. Although, all the other parameters assessed smoothly but I have encounterd a problem during isolation of microplastics...

05 June 2024 2,469 0 View

How can I select the exact value in Flow Accumulation to identify the streams during Basin delineation?

In basin delineation and hydrological modeling, selecting the exact value in Flow Accumulation to identify streams is a critical step. The Flow Accumulation tool calculates the accumulated flow as...

30 May 2024 6,107 1 View

Are multi-level models appropriate for binary outcome variables for DHS datasets? If yes, what is the process?

30 May 2024 2,035 2 View

If Concentration of DNA is 85ng/ul then calculate its concentration for 50ul reaction using Phusion Flash Master Mix?

can any budy explain how i calculate the DNA concentration for the 50ul reaction?

22 May 2024 9,557 1 View

If the sequence of the primers are given and size of the PCR product is 2500 then what will be the PCR profile for the given reaction?

If the sequence of the primers are given as: Forward: ATATAGACCAATATTCCTGTTAGCA, Reverse: AAAAATTAGCCGGGCGTAGTGGCG and size of the PCR product is 2500bp, then what will be the PCR profile for the...

22 May 2024 7,777 1 View

Is this a facetotecta nauplius?

This larva was captured using a plankton net in the Persian Gulf during the summer. I believe it may be a Facetotecta nauplius.

08 August 2024 3,746 4 View

May members post flyers about opportunities to present at a conference? If so, where to post?

May members post flyers about opportunities to present at a conferehttps://veraeducation.com/nce? If so, where to post for the Virginia Educational Research Association? https://veraeducation.com/

08 August 2024 4,585 1 View

How to generate a citation of my paper from ResearchGate?

How we can cite the papers from ResearchGate. I am trying to create citations for this article, Quantum Machine Learning Algorithms for Optimization Problems: Theory, Implementation, and...

08 August 2024 6,690 3 View

Hello all, Looking for international reviewer to review Ph.D thesis in wireless sensor network.Can anybody help?

My name is Apurva Saoji. I am a Ph.D scholar in Computer engineering in India. I am looking for international expert in reviewing my PhD thesis, "Competitive Optimization Techniques to Minimize...

07 August 2024 4,600 2 View

Is there anyone with experience in TEM analysis who can assist with a manuscript for an upcoming journal?

Hello dear colleagues, We have prepared a manuscript on NiTi-based alloys and are seeking a second opinion on our current TEM results. If you are a Ph.D. holder with experience in TEM and have...

07 August 2024 9,563 0 View

Hello Everyone ! I'm looking for a good journal to publish my manuscript with low publication cost?

I am Looking for a Science Journal with good impact factor and low publication cost to publish a review paper. Your suggestions would be appreciated.

06 August 2024 6,796 3 View

How to get links for copyrights for papers?

how to get links for copyrights for papers?

06 August 2024 7,410 1 View

How to determine positive-stained cells in FACS? Use isotype or unstained control?

To compare positive and negative cell populations in flow cytometry, should I compare unstained cells with antibody stained cells? Or with the isotype control? Most papers show comparison with...

06 August 2024 6,728 6 View

Research Methodology - Impact of Corporate Reputation on Stakeholders Behaviors?

Please can anyone support with the survey questions based on RQ measures and propose how to do it in FMCG industry and include as well the role of brand equity Thanks

06 August 2024 949 0 View

How to report results of Generalised Linear Mixed Models in a journal article?

Hi everyone, If you have written or come across any papers where Generalised Linear Mixed Models are used to examine intervention (e.g., in mental health) efficacy, could you please share the...

04 August 2024 4,130 4 View