Want to learn/know the 5'-ITR and 3'-ITR sequence of the Sleeping beauty transposon for designing the experiments working with Sleeping beauty transposase.
Want to learn the 5'- DRo's DRis and 3'-DRo's DRis sequence of the Sleeping beauty transposon for designing the experiment to work with Sleeping beauty transposase
They are, roughly:
5': atccctatacagttgaagtcggaagtttacatacacttaagttggagtcattaaaactcgtttttcaactactccacaaatttcttgttaacaaacaatagttttggcaagtcagttaggacatctactttgtgcatgacacaagtcatttttccaacaattgtttacagacagattatttcacttataattcactgtatcacaattccagtgggtcagaagtttacatacacta
3': tactaattgagtgtatgtaaacttctgacccactgggaatgtgatgaaagaaataaaagctgaaatgaatcattctctctactattattctgatatttcacattcttaaaataaagtggtgatcctaactgacctaagacagggaatttttactaggattaaatgtcaggaattgtgaaaaagtgagtttaaatgtatttggctaaggtgtatgtaaacttccgacttcaactgtatagggatcctctagcta
Pulled from the plasmid pT2-CAG-fGFP (https://www.addgene.org/108714/) and mapped based on the original paper by Ivicz et al (Cell. 1997 Nov 14;91(4):501-10.).
I say roughly, because no sequence or paper I've come across has bothered to annotate or detail the full sequences. Anyone else coming across this crap - you're welcome.
Figure 1 of a recent paper by Scheuermann et al. (PMID: 30718656), which has Ivics as one of the authors, gives the consensus sequence and some known variation.
- Badges
- Science topic
- Similar topics
- Psychology
- Mental Processes
- Learning