This is a species  Akashiwo sanguinea (K.Hirasaka) G.Hansen & Ø.Moestrup, 2000 (Syn. Gymnodinium splendens Lebour, 1925; Gymnodinium sanguineum Hirasaka, 1922)

Dear Mohammed, if that is the species then it is a red-tide blooming species - is there a history of eutrophication in the area? Have there been any associated symptoms such as fish kills, bird deaths, anoxia in the water column, benthos dying? It may become a public health issue as well. best wishes, Mike

Dear Mohammed,

I agree with Dr. Dimitar. Yet another reference is added.

Escobar-Morales, S. & Hernández-Becerril, D.U. (2015). Free-living marine planktonic unarmoured dinoflagellates from the Gulf of Mexico and the Mexican Pacific. Botanica Marina 58(1): 9-22.

Good luck!

Dear Mohammed,

I confirm that Akashiwo sanguinea is becoming more frequent in Mediterranean than the past. I can give to you another recent reference reporting the abundance of this and other harmful species. Regards

Caroppo C., Cerino F., Auriemma R., Cibic T. (2015) Phytoplankton dynamics with a special emphasis on harmful algal blooms in the Mar Piccolo of Taranto (Ionian Sea, Italy). Environmental Science and Pollution Research. DOI: 10.1007/s11356-015-5000-y.

This is Akashiwo sanguinea

Thank you all for you kind help.

Dr. Mke

The species was blooming and converting the water into dark brown so I called brown tide. no signs of fish mortality as far as I know but the plankton samples collected from the bloom and other nearby sites showed that samples away from the bloom had more zooplankton  than that from the bloom. Almost zooplankton was very rare in the bloom sample.

It was very difficult to sample again.

The species was collected only from the bloom and absent from other samples

Dear D Mohamed,

i suggest to confirm it with a molecular marker such as 18S gene.

i just designed a new 18S specific primers pairs for dinoflagellates to idetify unknown dinoflagellates and it was fine.

Dino_18s_F aytggagggcaagtcyggtg

Dino_18s_R tccaccaactaagaacggcc

Good Luck

Dear Mohamed,

I think so, it is kashiwo sanguinea. Do you record any field observation as mentioned by  Michael Elliott.

No, we are not able to visit the site again. Only some plankton samples and water samples for nutrient and chlorophyll were collected

Akashwo sanguinea

I confirm the species identification.

Akashiwo sanguinea .... really interesting to change the color of the water

All best