14 September 2019 0 9K Report

the primer sequences are as:

F-1 CTCTGTTCTCTCTTTCTCTCCTATC

R-1 CACTTGACGGTATATTATGAGCTTG

F0 GGATCCAAATGGCGTCCATC

R0 GGATCCTTAAGTTCTGGTTCGAA

More Saumya Raizada's questions See All
How to determine the melting or boling point of any chemical which is in the poweder form?

A new compound that is available for purchase to inhibit the particular target which have no literature regarding its physical properties, how will I calculated its melting or boling point for...

24 May 2024 2,932 4 View

How do I increase the overall and kappa accuracy of LULC image ?

I have the LULC (Land Use Land Cover) image set; please recommend me any standard way to improve the accuracy of these images.

06 December 2023 2,321 2 View

Nanoparticle cellular uptake?

Is there a specific reason why nontoxic, negatively charged nanoparticle cellular uptake decreases as the concentration increases?

02 December 2022 8,733 3 View

Can I calculate the euphotic depth if I have surface PAR and the water column chlorophyll data?

I am looking to calculate the euphotic depth using surface PAR and chlorophyll concentrations. Morel 1988 has mentioned that for case I waters the pigment concentrations (Ctot) and euphotic depth...

18 May 2021 8,174 0 View

How can I avoid clumping of TiO2 rod-like particles in the water meniscus?

I have rutile TiO2 grown on Si rods(100 microns long) with Ni bulb on one end of the cylindrical rod. They are supposed to float on the surface of the water but they tend to clump. How can I...

05 November 2020 9,205 2 View

How do I find out whether my ionic liquids are encapsulated in nanoparticles?

I am planning to make Ionic liquds encapsulated PLGA nanoparticles. Are there good techniques that I can confirm the capsulation of the ionic liquid? Thank You in advance!

06 October 2020 5,722 3 View

Can you recommend a polymer which has viscosity as low as water or somewhere in that range?

I want to embed some metallic particles in a polymer (like PDMS which is very viscous for my purpose) by coating a glass slide with it, drop-casting the particles on it, and then subjecting it to...

26 September 2020 5,631 4 View

Is there a way to increase the surface tension of water ?

Preferably 2 -3 times the normal value.

06 September 2020 1,007 25 View

Can anyone explain how GNC app in cytoscape works?

What will be the input file in cytoscape for which interaction needs to be checked?

28 May 2020 7,007 0 View

Fluorescently tagging sigma factors?

Hi Has anyone successfully made a fluorescent protein fusion to any sigma factors in bacteria? I am trying to tag sigma 70 in E coli and was looking for literature to assess what would be a good...

17 April 2020 9,872 2 View

Similar questions and discussions
What is the physical meaning of the magnetic scalar potential?

In cases where the rotational of the magnetic field H is zero, we can define this field as the gradient of a scalar function defined as the magnetic scalar potential (similar to the electric...

21 July 2024 9,633 4 View

Why Is My mtDNA Ct Value Higher Than Nuclear DNA in qPCR?

Hello everyone, I'm currently working on calculating the relative levels of mtDNA using qPCR by comparing the Ct values of a mitochondrial gene (nd1) and a nuclear gene. According to my...

16 July 2024 5,508 0 View

How can i generate a CRISPR knockin mutation zebrafish model with a reporter?

Hey! I aim to generate a transgenic knockin zebrafish line that mimetizes a genetic condtition that leads to a certain disease on human. To do so, I need to insert a codon for mutagenic aminoacid...

14 July 2024 6,240 0 View

Where is the stream gradient usually greatest and relationship between the slope of the stream channel and the velocity of the stream?

Where is the stream gradient usually greatest and relationship between the slope of the stream channel and the velocity of the stream?

13 July 2024 5,825 0 View

How do gradient and discharge change in a downstream direction and why are glacial valleys shaped differently from river valleys?

How do gradient and discharge change in a downstream direction and why are glacial valleys shaped differently from river valleys?

13 July 2024 9,228 3 View

What happens to stream's discharge if gradient of a stream increases & relationship between gradient of a stream & rate of water flow?

What happens to the stream's discharge if the gradient of a stream increases and relationship between the gradient of a stream and the rate of water flow?

13 July 2024 5,085 2 View

How does that stream's gradient change downstream as it enter the alluvial fan and difference between an alluvial plain and a delta plain?

How does that stream's gradient change downstream as it enter the alluvial fan and difference between an alluvial plain and a delta plain?

12 July 2024 7,337 0 View

How does stream gradient steepness change moving downstream and gradient of a stream change along its longitudinal profile?

How does stream gradient steepness change moving downstream and gradient of a stream change along its longitudinal profile?

12 July 2024 4,113 0 View

How to produce homogeneous reference gene bands in Western Blot?

Hello, I have been performing Western Blots to study the protein levels of a rodent skin and muscle sample. However, I have not been able to produce homogenous reference bands. I suspect that...

26 June 2024 5,913 3 View

What is wrong with Site-Directed Mutagenesis?

I am following the NEB protocol to perform SDM with Q5 and NEB HiFi Assembly. I am making a two base pair change. First picture is my Primers designed with NEBaseChanger. Second Picture is my...

24 June 2024 6,079 4 View

Our partners will collect data and use cookies for ad personalization and measurement. Learn how we and our ad partner Google, collect and use data. Agree & close