the primer sequences are as:
F-1 CTCTGTTCTCTCTTTCTCTCCTATC
R-1 CACTTGACGGTATATTATGAGCTTG
F0 GGATCCAAATGGCGTCCATC
R0 GGATCCTTAAGTTCTGGTTCGAA
I have rutile TiO2 grown on Si rods(100 microns long) with Ni bulb on one end of the cylindrical rod. They are supposed to float on the surface of the water but they tend to clump. How can I...
05 November 2020 9,068 2 View
I am planning to make Ionic liquds encapsulated PLGA nanoparticles. Are there good techniques that I can confirm the capsulation of the ionic liquid? Thank You in advance!
06 October 2020 5,560 3 View
I want to embed some metallic particles in a polymer (like PDMS which is very viscous for my purpose) by coating a glass slide with it, drop-casting the particles on it, and then subjecting it to...
26 September 2020 5,454 4 View
I have cloned MAPK3 in BL21 cells. I have already tried protein induction at 37, 28 and 22 degree Celsius with IPTG conc ranging from 0.4mM to 2 M. But I got no protein induction. I have also...
16 July 2018 3,976 3 View
15 May 2018 7,143 13 View
I am trying to clone two genes in pET 28a vector using BamHI and XhoI sites and BamHI and EcoRI sites respectively. I am purifying the PCR product before digestion using Qiagen kit, but in the...
06 May 2018 8,123 8 View
Can anyone please suggest me a tcl script for the same. I have tried using a script but its returning the same values for the center of mass for all the residues.
24 November 2014 3,859 1 View
I read about CNT doping in CNTFET that beneath the gate CNT should be intrinsic and source and drain are n/p doped. But if I compare it with MOSFET, shouldn't the CNT beneath gate be doped with...
13 January 2014 9,750 1 View
Hi, could anyone recommend a plasmid and/or protocol for reporter gene assay in S. cerevisiae? I want to assess the effect of growth conditions on a transcription factor, so I want to clone it`s...
01 March 2021 210 1 View
I have tried Idelchik's Handbook of Hydraulic Resistance 4th Edition (2007 page 300) formulas and across some range the formulas are reported valid for, the law of conservation of energy is...
20 February 2021 2,504 1 View
14 February 2021 4,194 3 View
I think I've seen it previously, but the current example is from this publication https://www.mdpi.com/1420-3049/14/5/1825 where they used the following gradient on HPLC: min ... % MeOH 0 ... 2 20...
09 February 2021 5,422 3 View
Hello. I have a viral plasmid which contains a bicistronic region: CMVprmtr-GFP-IRES-PuroR. I would like to cut out the GFP sequence to get rid of the green fluorescence. In this case, would it be...
02 February 2021 1,644 7 View
Hi Everyone: I have a question regarding to qPCR. I am trying to do RT-PCR, and I want to have equal amount of input DNA for my RT-PCR, so I normalize my DNA input based on qPCR values of a...
31 January 2021 6,977 4 View
I'm currently trying to purify Outer Membrane Vesicles (OMVs) following their extraction from the bacteria I'm working with. After the initial extraction the concentration of protein seems good...
27 January 2021 6,852 3 View
I ran PCR in order to analyze a P-element excision on a mutant drosophila line. My results were not conclusive, however that is beside the point. I ran a temperature gradient in order to optimize...
25 January 2021 9,164 11 View
- The Eppendorf tube was then placed in a microcentrifuge. Notice how it is balanced with another tube placed opposite it in the centrifuge drum to ensure smooth rotation. Other information...
24 January 2021 2,547 3 View
My environmental sample was analyzed for fungi by both DGGE (18S) and NGS (ITS2), resulted in some different names (in the top 5 of strong bands in DGGE, or most abundant sequences in NGS) between...
21 January 2021 5,310 3 View