Why does a Nested PCR protocol amplify samples and not amplify positive control?

I have this problem. Today I used a new positive control of an isolated NC-1 strain in cell culture and the problem persists. I performed a serial dilution test to test the sensitivity of the...

08 December 2020 6,252 2 View

How to avoid the formation of traces and dimers in DNA gel electrophoresis?

07 December 2020 3,052 3 View

Is the pipetting order of the positive and negative controls in the PCR important to avoid in a possible contamination?

I have been watching bands form on my negative controls. I have already changed all reagents, optimized the hygiene of materials and the environment and increased care in pipetting.

07 December 2020 9,090 3 View

How to standardize and obtain a good PCR reaction with samples with a low and variable amount of DNA?

I work with the detection of N. caninum DNA in milk samples in milk samples. The DNA concentrations in my samples range between 2-90 ng / ul. I would like to establish and standardize a final...

01 December 2020 8,792 3 View

Measure of intracellular lactate?

Hi! I will try to measure intracellular lactate through lysing the cells in 20 mM Tris-HCl, 150 mM NaCl and 1% NP40. I'm going to use a clinical kit, which is constituted of Pipes buffer, pH 6.8....

30 January 2020 5,211 2 View

Dissolved oxygena DYE for cell culture?

Hi, I am looking for a dye to monitor O2 changes in cell culture media. I would like to have it colorimetric and not fluorescent but since I am not finding anything I could to fluorescent too! I...

23 October 2018 5,895 2 View

How do I determine the sample size to evaluate the performance of an image segmentation algorithm?

I have three image segmentation techniques that I have developed. I wish to compare the performance of the segmentation techniques using measures such as BDE(boundary displacement error),...

11 October 2018 2,021 5 View

Most appropriate Feature Selection to find indicators that are most correlated to the number of one event?

I have two databases. One of them contains the number of this event per year. The other one contains a lot of indicators and its values per year. I want to find those indicators that are most...

20 March 2018 3,610 4 View

Which is the best way to treat ticks and fleas for morphological identification before performing molecular investigations?

Hello all, I am trying to attempt morphological identification of ticks and fleas collected in Wales on wild small rodents. My samples have been frozen and after the morphological identification I...

10 October 2017 7,374 4 View

Is it a problem to have a positive dG in primer self dimer?

5' GGCATGTAACGAATTTCTTC 3' +++ ||| 3' CTTCTTTAAGCAATGTACGG 5'dG: 1.5 Data from Gene Runner

24 May 2015 4,243 6 View

Guidelines for survey (question type) analysis?

Hi. Please tell me what guidelines should i need to follow for questionaries' type research work in India. It is not hospital based work, we are conduction basic institutional based qualitative...

03 March 2021 2,037 3 View

Enhanced Yellow Fluorescent Protein (Aequorea victoria) DNA sequence?

I am on the lookout for the Enhanced Yellow Fluorescent Protein (Aequorea victoria) DNA sequence. Does anyone know where I can find it? Thank you in advance

03 March 2021 3,568 1 View

How to increase a model accuracy ?

dear community, my model is based feature extraction from non stationary signals using discrete Wavelet Transform and then using statistical features then machine learning classifiers in order to...

03 March 2021 6,994 5 View

How to access MSCI KLD Stats and Sustainalytics?

Hello all, I'm currently working on my undergraduate thesis and I'm having difficulties trying to access KLD Stats and Sustainalytics because my campus Airlangga University and apparently other...

02 March 2021 8,525 1 View

Ideas for Phd's Thesis on pricing (Marketing)?

Hi everyone, I'm studying Marketing and I would like to write my PhD thesis on the topic of pricing. Any specific ideas?

02 March 2021 9,706 5 View

No title

02 March 2021 3,060 3 View

No title

02 March 2021 932 1 View

What are the most reliable approaches to extract key continuous frames from a video, with complete automation?

I have an input video, of skin (from a microscope that means it is magnified such that blood capillaries are visible). The idea is to extract 15 sec of continuous frames from a video of 1 min,...

02 March 2021 2,735 2 View

How to calculate BREQ 3 questionnaire?

how to calculate BEHAVIOURAL REGULATION IN EXERCISE QUESTIONNAIRE BREQ 3 ,which contain 24 questions and each question has 5 answers (0- Strongly disagree , 1-disagree, 2- Neither agree nor...

02 March 2021 811 3 View

Please suggest a good text book for "Research Methodology in Life Sciences". Which book would be good for PhD Scholars?

Please provide Book Title and author name

02 March 2021 9,059 3 View