How to Calculate DNA to Protein Ratios in an EMSA reaction?

29 June 2023 0 3K Report

The DNA i am using is 157 bp. The sequence is here:

ACGCGTCGGTGTTAGAGCCTGTAACTCGGTGTTAGAGCCTGTAACTAGTCTGCAGGTTACCTAGGACTTCAGGCACCCAGGCTTCGTACATCAAGCTTCATCGGGGGCTATAAAAGGGGGTTCCTCGAGGTTCCCTGGGACACTGTCTAGAGAATTC

I am using 25 ng/ul of DNA in one reaction and 100ng/ul in another reaction

Protein I am using is 6 and 12 uMol in concentration.

Thank you in advance for your help.

Badges
Science topic

More Rohan Shastri's questions See All

Is there any published or unpublished statistics on dropout rate (Dose1 to Dose-2) for Covid-19 vaccination in India, US, UK or any other country?

Are there any published or unpublished statistics or papers on the dropout rate (Dose1 to Dose-2) for Covid-19 vaccination in India, USA, UK, or any other country where vaccination has started at...

28 February 2021 4,237 1 View

How to find out or construct(?) the right priors from data of previous experiment to use in a bayesian glm?

I have the following equation, Eating choice (Yes/No)~ Box type (A/B/C). So the question is whether a certain box type affects eating choice in groups of dogs. The eating choice of each member in...

10 February 2021 6,024 9 View

How can a publish my case report?

I want to publish a case report regarding jejunal diverticula

02 January 2021 7,630 5 View

How to calculate the dimensions and frequency, etc. of a pulse tube for required cold/hot temperatures?

Require to know the methodology for calculating dimensions (Lenght, diameter), operating frequency, etc. of a simple pulse tube refrigerator. Reference to handbook or manuscript would also be helpful.

29 September 2020 2,191 2 View

Is there any cost-effective, simple and efficient way to analyse and estimate the amount of vitamins in algal samples?

I am currently pursuing my research in Phycology. I'd like to know if there's any simple and cost-effective method to detect and analyze nutrients and vitamins in the algal matter. The experiment...

18 September 2020 4,081 3 View

Which research institutes in India have an algal identification facility?

I am currently pursuing my research in Phycology and planning to conduct a study on microalgae. Is there any place where I can send my samples to be identified? (Preferably in South India) Also,...

17 September 2020 4,440 2 View

Reaching out about helping in empirical research!?

Dear all, It is a kind and humble request to fill the following survey questionnaire. Your cooperation is highly appreciated in this regard. It will not take more than 10 minutes of your time. The...

31 August 2020 5,650 5 View

Could anyone please summarise in short about what Kalman filter is? Or suggest a good article for that? Can it be used to get DC value of a signal?

I want to understand the overview of Kalman filters and what purpose do they serve. I am trying to leverage this platform as I am not sure about other authentic sources on the internet to get this...

09 August 2020 7,440 4 View

Ideal qualities of a researcher: Let's share our opinions?

Opening a debate on the qualities of an ideal researcher...

24 July 2020 9,819 5 View

Retractions in publishing (often found across journal issues now): Discussing the reasons, journal policies, consequences n mitigation strategies?

Retraction is a pain in publishing: Opening a debate on this ever-evolving and a topic of wide concern.

24 July 2020 1,386 11 View

How to compare two groups with only two measurements?

Hiiiii everyone! I have an enquiry on statistical analysis. I was looking for many forum and it's still cannot solve my problem. I want to compare means of two groups of data but only with two...

03 March 2021 8,796 3 View

Protein-aptamer gel electrophoresis help, please??

Hi, I have problems with running gel electrophoresis. I have tried agarose gel electrophoresis and native PAGE. I have two proteins, which have molecular weights of ~30kDa and ~180kDa and two...

03 March 2021 4,275 4 View

Enhanced Yellow Fluorescent Protein (Aequorea victoria) DNA sequence?

I am on the lookout for the Enhanced Yellow Fluorescent Protein (Aequorea victoria) DNA sequence. Does anyone know where I can find it? Thank you in advance

03 March 2021 3,568 1 View

What kind of fluid could I use for a pitfall trap that also does not invalidate molecular testing?

Hi, I want to start testing pitfall trap to obtain ants samples, but I need to conduct molecular analysis on those insects. So, what kind of fluid can I use? Ethanol expires too early and I need...

03 March 2021 5,978 5 View

What's the best way to measure growth rates in House sparrow chicks from day 2 to day 10?

What's the best way to measure growth rates in House sparrow chicks from day 2 to day 10? Since, the growth curve from day 2 to 10 won't be like the "Logistic curve" it might not follow logistic...

03 March 2021 1,401 3 View

Does any one know how i can prepare liver tissue with transmission electron microscope with good fixation?

i have problem in preparation of liver tissue with bad cell organelles and how i can adjust osmolarity

03 March 2021 8,890 1 View

Do we need to write protocol for a second study of a systematic review that has been registered and published?

I have conducted and published a systematic review and meta-analysis research with the topic related to public health and health pomotion (protocol was registed in PROSPERO). Now we want to...

03 March 2021 8,920 3 View

How to increase a model accuracy ?

dear community, my model is based feature extraction from non stationary signals using discrete Wavelet Transform and then using statistical features then machine learning classifiers in order to...

03 March 2021 6,994 5 View

Do I need to do linear regression before running mediation analysis using PROCESS MACRO by Hayes ?

I just wanted to check if I need to run a linear regression separately if I am using PROCESS MACRO to run mediation analysis. Thank you.

02 March 2021 4,359 3 View

Gel electrophoresis result for total RNA samples, 1.5 Agarose gel was used, How to improve the integrity of RNA?

Gel electrophoresis, RNA degradation, RNA extraction from fresh tissue

02 March 2021 5,433 5 View