How to assay the polymorphism of short SSR/indel (1-6 bp) between to cultivars?

01 January 1970 1 2K Report

How to assay two variants in a gel-based assay or any simple assay if their polymorphisms are due to very short indels/SSRs; such as example below:

ACCGATATATATATGCGTCGTGAGT

ACCGATATATATATATATGCGTCGTGAGT

Thanks,

Richard

Shanta Karki

Use PAGE to run your PCR peoducts!

Badges
Science topic

Similar topics
Microbiology
Assays

Does Anyone have expertise in in vitro transcription and RNA pull down assay?

I am currently working on LncRNA; to know the lncRNA-protein interactions I want to do RNA pull down assay, so I need to design primers with T7 promoter. I need assistance in this regard.

07 August 2024 6,622 1 View

How to improve plaques in Double Layer Agar Assay?

Hi all! My thesis groupmates and I are working on purifying an E. coli bacteriophage. The phage was handed down to us by the previous thesis group, but they only managed to purify it to about...

06 August 2024 5,801 4 View

How do we pick data for determination of Validation Acceptance Criteria?

Hello, colleagues! There is commenting open for new upcoming edition of USP 1033. Validation target acceptance criteria is now different from what it used to be and it doesn't include Cpm....

23 July 2024 7,292 3 View

Are there any alternatives to PhenoScanner?

I am currently conducting a mendelian randomization study, and I was attempting to use PhenoScanner to look for potential confounders associated with the selected SNPs (any SNPs significantly...

23 July 2024 5,703 0 View

Can anyone suggest the specification of the test tube used for the tube adherence method for biofilm assay?

when we grow biofilm in test tube, the pipette often do not reach near the content. so we have to decane it directly or use a smaller test tube.

17 July 2024 3,532 0 View

Trouble finding an anti-Digoxigenin antibody to perform Southern Blot technique?

I'm currently using Roche anti-DIG-AKP Fab fragments to perform Southern Blot assays, but this reagent is delayed since november last year. It's anybody facing the same problem? If so, how are you...

15 July 2024 6,668 0 View

Techniques regarding protein-protein interaction in vitro?

What techniques or assays will be used when a purified lyophilized powder is purchased from a company to study protein-protein interaction?

15 July 2024 1,598 3 View

What would you do next?

Studying a specific monogenetic disease based on mutations in different individual genes. I try to recreate the disease phenotypes of donors in vitro. I knocked out a gene x with above 90%...

12 July 2024 6,313 0 View

Does sucrose interfere with the BCA reagent in peptide concentration assays?

Hello everyone! I am currently working on the expression and purification of an antimicrobial peptide that experiences reduced activity after each freeze-thaw cycle. To improve its stability, I...

10 July 2024 6,830 1 View

How to assess the viability and manage debris in fish primary cell cultures?

Hi, I would appreciate professional and technical insights regarding primary cell culturing. I've been working on optimizing my primary cell culture, and while it is successful at times, there are...

10 July 2024 4,918 2 View