How to assay the polymorphism of short SSR/indel (1-6 bp) between to cultivars?

01 January 1970 1 2K Report

How to assay two variants in a gel-based assay or any simple assay if their polymorphisms are due to very short indels/SSRs; such as example below:

ACCGATATATATATGCGTCGTGAGT

ACCGATATATATATATATGCGTCGTGAGT

Thanks,

Richard

Shanta Karki

Use PAGE to run your PCR peoducts!

Badges
Science topic

Similar topics
Microbiology
Assays

How to quantitative analize the data of TNBS assay for gelatin?

Estemeed colleagues, I found some issues regarding the quantification of the data for TNBS assay. There are different protocols on how to perform that but it is clear to me the "fil rouge" that...

02 March 2021 2,616 1 View

How to simultaneously perform multiple biochemical assays?

I am a research scholar working on heavy metal stress on plants. I will be doing biochemical characterisation( protein, carbohydrate, proline, antioxidant enzymes and many more assays) at interval...

01 March 2021 6,999 3 View

Is CD44 degraded in lysosome together with hyaluronan after CD44 mediated endocytosis of hyaluronic acid?

Also when RHAMM binds hyaluronic acid, they get internalized, will RHAMM also be degraded? Or both CD44 and RHAMM will be transferred back to the cell membrane? Asking for breast cancer cell line...

01 March 2021 8,169 2 View

RIA. How to measure?

When you use RIA, with a control the unknown sample with antibodies, you bare in mind the binding sites of the antibodies. However you still need to measure labelled antigen (radioactive) and not...

28 February 2021 2,133 3 View

Why am I not able to use all VEP programs for the in silico analysis of avpr1b SNP's?

Good day researchers I am busy analysing the predicted effects of certain SNP's in AVPR1b. When using the VEP prediction programs (SIFT, Polyphen, FATHMM, LRT, Provean, Mutation Assessor, and...

28 February 2021 5,197 1 View

What is the difference between genotype and haplotype data in the ped format?

Hi everybody In the ped format for genotype, alleles of any SNP are represented by two columns (one for each allele, separated by a space). Is a column sufficient for the haplotype to...

27 February 2021 1,965 1 View

I have a time series data of some biochemical studies ( DNA and Chromosomal damage) which I intend to use to further predict into future ?

I have a time series data of some biochemical studies ( DNA and Chromosomal damage) which I intend to use to further predict into future without necessarily conducting the assay for an extended...

23 February 2021 7,842 1 View

What is the standard protocol in doing replicates for C. elegans lifespan assay on solid media (thru worm picking)?

I would like to know what is the standard protocol in the number of worms per plate and number of plates per concentration of extract X in a lifespan assay done in solid media and not automated...

23 February 2021 9,933 1 View

Why anti-CD20 or other antibodies are not used to label target cells in flow cytometry t-cell cytotoxicity assay?

New to the field of cell therapy. Why fluorescent-labeled antibodies to target cell antigens are not used for determining target cell count by flow cytometry in cytotoxicity assay (eg car-t)? Cell...

21 February 2021 3,278 3 View

Can anyone help or comment on solubilising chlorobutanol in aqueous injections in minimum time possible?

Please suggest solubilisation of chlorobutanol in injections. Tried pH and high temperature. But the issue is of assay drop. If anyone can suggest any solution. Its a commonly used excipient for...

21 February 2021 7,397 1 View