for supporting the question, necessary image has been included
After COVID-19 it has seen that EFL learners technological affiliation has raised. In addition, in the post-COVID period learners started to engage AI technologies like ChatGPT while learning...
08 August 2024 8,964 4 View
How we can cite the papers from ResearchGate. I am trying to create citations for this article, Quantum Machine Learning Algorithms for Optimization Problems: Theory, Implementation, and...
08 August 2024 6,690 3 View
I am currently working on LncRNA; to know the lncRNA-protein interactions I want to do RNA pull down assay, so I need to design primers with T7 promoter. I need assistance in this regard.
07 August 2024 6,622 1 View
I want to refine one XRD peak of my in-situ xrd but the background is never working good which ultimately fails the refinement. How to refine and adjust the background using GSAS-II
05 August 2024 5,291 2 View
Hi, i would like to simulate an absorption process in Aspen Plus. I want to use the NRTL model und would like to add some individual Henry coefficients. Is that possible and how?
05 August 2024 2,333 2 View
Hello everyone, I'm encountering an issue with my electrochemical impedance spectroscopy (EIS) measurements and would appreciate some insights. Experimental Setup: Electrodes: Gold interdigitated...
05 August 2024 3,783 2 View
AI tools like ChatGPT can enhance research work significantly when used responsibly and in conjunction with thorough human oversight.
05 August 2024 1,842 3 View
Have you ever seen a LC-MS/MS method uses both internal standards and external standards (in matrix matching purpose) but the concentrations of internal standards are outside the calibration curve...
05 August 2024 3,084 6 View
Hi everyone, I am working on brain slices for visualizing a protein in the soma and dendrites, using a fluorescence tag. However, I need a tool (not paid) for reconstruction of the whole neuron,...
04 August 2024 4,725 2 View
Citi BLOC Standard Basket Definitions: A standardized unit representing a fixed basket of construction materials, labor, and equipment costs priced in various cities. Purpose: To create a common...
04 August 2024 8,997 1 View
Hi everyone, Recently I have been conducting Dynamic Light scattering experiments in a micellar solution at 5 and gel at 37 degrees of Celsius with latex particles of diameter 190-500 nm. While...
01 August 2024 1,168 4 View
Hello, I'm trying to measure the conductivity of semiconductor films but since I don't have a commercial four point probe set up I would like to build one on my own in my lab. I have generators,...
30 July 2024 906 2 View
I designed 2 dual hybridization probes for my single SNP. where I attach my fluorophore 5'-FAM-nnnn-BHQ1-3', and 5'-HEX-nnnnnn-BHQ2-3'. I need to run it on the MIC RT PCR machine by Biomolecular...
28 July 2024 5,658 0 View
Dear colleagues, We are trying to do FISH on mice PDEC metaphase spreads. We use homemade biotin labelled probes, synthetized using a nick translation kit. For hybridization, initially we were...
08 July 2024 8,687 3 View
I have a target of sequences for primer design for qPCR with taqman. The issue is that when I design a sense probe the probe makes dimers with forward and reverse with a very high probability at...
16 June 2024 1,506 1 View
Hi all, you know this lncRNA has 12 exons and 50 isoforms that just have similar sequences in exon 12. Coud someone recommend me primers for this exon with no need of probes?
15 June 2024 8,055 0 View
It is very common to measure the pressure distribution inside the bearings with pressure probes connected to the oil film through holes in the bush. Once filled and pressurized, the probe lines...
12 June 2024 1,936 0 View
I was recently performing a great deal of qPCRs on adipose tissue derived RNA. I had experimental samples from sick, and control samples from healthy individuals. I used the same chemistry for all...
04 June 2024 6,924 0 View
this primer and probe are specific to the mthfr gene (C677T) AGGCCAGCCTCTCCTGACTG AGGACGGTGCGGTGAGAGTG Taq man probe: CGGGAGCCGATTTCATCA—FL 640-CGCAGCTTTTCTTTGAGGCTGACA—PH
03 June 2024 239 2 View
Hi, I am looking for some low molecular weight organic compound/dye that absorbs light above 600 nm up to 750 nm with a decent absorptivity, that is reactive to amines or has a carboxilic acid...
22 May 2024 2,803 5 View
