How many fungal isolates are needed to present the whole population phenotypically and genotypically in general?

15 January 2017 1 9K Report

Hi All,

I was wondering How many fungal isolates are needed to present the whole population phenotypically and genotypically in general? How can I test the numbers of the isolates used are large enough to present the whole field population?

Thanks,

Jing

Bamigbegbin B. John

Typically, there are no minimum or maximum recommended sample size or isolates. This should be determined by the scope and objective of your research. However, for statistical analysis and population representation, the larger the sample size or isolates, the better dependable and useful your conclusions will be.

If you share with us your research objectives, I could suggest or advise on the experimental design and sample size.

John B. Bamigbegbin

+2348038645425

[email protected]

Badges
Science topic

Similar topics
Biological Science
Genetics

More Jing Jin's questions See All

Is there any solar electric power plant having the concentrated photovoltaic modules?

The solar photovoltaic (PV) power plant uses commercial (non-concentrated) PV modules which are quite simple in design and reliable. They can work on fixed orientation and don't need the moving...

16 February 2021 3,796 9 View

Control in microstructure with growth inhibitor?

Dear researchers, I wish to understand the role of grain growth inhibitor in controlling the microstructure of the ceramic pellet. How it controls the growth? Also, I wish to know the grain...

15 January 2021 3,859 3 View

Does behavior (shy vs bold; rare vs abundant) and flock size (small vs large) of bird species play role in niche partitioning among sympatric species?

Sympatric birds may avoid competition via multiple strategies - by different activity period, different diet, different microhabitat etc. Has any one looked into behavior of sympatric birds as...

11 January 2021 9,600 1 View

Buckling of Smart composite plates using FEM ( MATLAB code)?

Can anyone help me with the FEM coding for Buckling of composite plates using the FSDT or HSDT - Source or the helping material (textbook, research paper etc) - Geometric stiffness matrix...

03 January 2021 3,059 3 View

How much the nanoparticles reach the inflammatory tissue?

Dear colleagues, I want to know the average analysis data of EPR effect on inflammatory tissue (acute lung inflammation/injury, ischemia/reperfusion, rheumatoid arthritis, and sepsis..) In...

22 December 2020 3,147 2 View

Optimization technique in ball mill?

Hi all, I wish to know about a common problem faced by most of the researchers who are dealing with ceramic materials that my ceramic powder is sticking with the balls after the operation. can...

02 December 2020 8,232 3 View

Smear in PCR product after purification, how to get rid of it?

I've done a PCR using primers Forward: CGCCATCAAGGTACCAGTTGA and Reverse: CAGGCTCAGGTACAGCTGGTGG AGTCTGG saw a band at around 400bp and purified my PCR product using QIAquick PCR Purification...

28 November 2020 1,701 7 View

Exergy destruction mathematical calculation in kW?

somebody, please elaborate on how to calculate exergy destruction in kW units. from Aspen HYSYS I found mass exergy with kJ/kg unit and i don't know how to calculate it by using Aspen HYSYS and if...

25 November 2020 2,675 3 View

I am looking for the dataset to test the algorithms for Radar Emiiter Classification?

I am working on Radar Emitter Classifiers and I want test my codes. unfortunately I'm unable to find a dataset to test my algorithms. I'll be glad if someone can help me with this...

04 November 2020 3,988 3 View

How to link excel with Aspen plus?

Is there any way to connect excel data sheets with aspen plus as inputs to perform parametric analysis?? I want to change input parameters for a certain range to see system performance

28 October 2020 2,174 3 View

Which is the best place in the world for the plant biotechnology research?

I am searching for a good place for the Post Doc,

02 March 2021 4,053 3 View

Which bacteria are suitable for quorum sensing screening?

I want to find a quorum sensing inhibitor from plant extracts. Klebsiella pneumoniae, Moraxella catarrhalis, Staphylococcus aureus, and Streptococcus pneumoniae. I looked for these strains...

01 March 2021 7,675 3 View

Isolates of Hymenoscyphus fraxineus?

Dear Dr. Cai, my name is Simone Prospero and I work in the team of Phytopathology at the Swiss Federal Institute for Forest Snow and Landscape Research (WSL;...

01 March 2021 1,133 1 View

Where to find data on trees in tropical agroforestry?

Hi, I'm looking for data (mainly related to management: growth rate, canopy size, soil and climate preferences, etc.) about tropical trees used in tropical agroforestry. Have you ever heard about...

28 February 2021 7,356 8 View

How to remove fatty material from plant extract?

The resultant solid was partitioned three times with 250 ml of petroleum ether (40-60/c) to remove any fatty material and evaporated to dryness.

28 February 2021 9,464 2 View

How to eliminate Steady state error from Reinforcement learning genetic algorithm code?

The following code (see 1st 2 images attached) is used to produce PID controller values that are designed to control the system (G). The code finds the PID controller values (noted as k) by using...

28 February 2021 6,560 14 View

Good morning research fellows, Has anyone worked with senna alata plant extract on any kind of fish?

Literatures on the piscicidal effect of sennaa alata is scanty. if you have any related litrature either in the bark, leaves or roots used as treatment to any aquatic organism please kindly help...

28 February 2021 9,138 2 View

The Shannon's index is inversely proportional to Simpson's index (1-D)?

I'm having a problem with my bloxplot with Shannon's and Simpson's indexs. The value of Shannon for my Community 1 indicating higher diversity (in relation of the Community 2), but have lower...

26 February 2021 3,033 9 View

What HPLC Marker(s) should be used to detect anthocyanins in a sample?

What HPLC Marker(s) or standard is used to detect and quantify anthocyanins such as Delphinidin, Cyanidin in a given sample of plant extract?

23 February 2021 1,832 4 View

How to constrain genetic algorithm input u?

My real system (buck converter) can only take an input of 0 to 1 (duty ratio) and I need to constrain the system so the controller action keeps within this bounds. How can I do this? The code for...

22 February 2021 2,125 3 View