How can I calculate the sparking voltage for electrostatic precipitator?

01 April 2023 0 1K Report

How can I calculate the sparking voltage for the electrostatic precipitator?

If the wire-plate distance is 5 cm?

Badges
Science topic

More Moath Bani Fayyad's questions See All

How can I check the primer and probe on NCBI?

this primer and probe are specific to the mthfr gene (C677T) AGGCCAGCCTCTCCTGACTG AGGACGGTGCGGTGAGAGTG Taq man probe: CGGGAGCCGATTTCATCA—FL 640-CGCAGCTTTTCTTTGAGGCTGACA—PH

03 June 2024 239 2 View

Is this Materials express Journal indexed in Scopus?

is this Materials express Journal indexed in Scopus? https://www.ingentaconnect.com/content/asp/me/2022/00000012/00000012;jsessionid=1hrkcsa57d1if.x-ic-live-03

10 November 2023 6,256 2 View

How can theories be systematically categorized into economic and corporate governance, and sociology and psychology domains?

Greetings fellow researchers, I am currently engaged in a comprehensive study that involves an in-depth analysis of various theories, and I am encountering a challenge in categorizing them into...

28 September 2023 2,945 2 View

How to prepare the following denaturation buffer: [2% SDS, 1 M β-mercaptoethanol (β-ME)]?

Hello, I hope analytical chemistry people or biochemistry major fellows could help me. Kindly advise on how to prepare the following denaturation buffer: [2% SDS, 1 M β-mercaptoethanol...

17 September 2023 3,936 3 View

What's the recipe for the "denaturation solution" for the endo-H sigma?

I want the home-made recipe of denaturation solution (5x per ug protein), for the "Endoglycosidase H - Sigma-Aldrich". Thank you in advance.

13 September 2023 726 0 View

Which App for AI can use it with smart phone?

I need app for AI can use it with mobile

26 March 2023 3,537 4 View

Finding Max Peak Gain vs Frequency using CST?

Everytime I run the simulation to find the maximum gain I receive the following error: {{ Template based post-processing result "GainTheta0Phi0": Error in calling "Evaluate1D" function ((9999) No...

14 February 2023 5,658 0 View

I am wondering if there is a way of calculating the diffusion length and lifetime of minority carriers of solar cells through the I -v curve?

I am wondering if there is a way of calculating the diffusion length and lifetime of minority carriers of solar cells through the I -v curve

03 January 2023 6,118 0 View

What recommended protocol for Cycloheximide chase assay with transiently transfected Hek293T?

Hello Scientists, I am working on assaying the half life of a plasma membranal protein which is transiently transfected into Hek293T cell line using FuGene-HD transfection reagent. Kindly, if...

24 November 2021 2,353 1 View

How do you justify the violation of Gricean Cooperative Maxims in a text?

A number of research work have been done employing the Cooperative Maxims in conversational text. How do I justify the violation of the maxims in a non-conversational text like medical and police...

04 October 2021 7,664 0 View

Can anyone explain why there is not any color bands in the middle portion of the tensile coupon?

Details of the Analysis. Static Analysis Composite Layup Continuum Shell Elements FRP Material (Elastic and Hashin Damage)

03 August 2024 8,538 4 View

Why might I be observing hysteresis in my stress-strain curves when using the Mohr-Coulomb model, despite not applying dynamic loading?

While working on caisson foundation, I applied static vertical load

25 July 2024 9,357 1 View

65% saturation of ammonium sulfate in 100 ml? (for protein precipitation)?

Hi All: I need to precipitate extracellular protein from supernatant. A bit confused with ammonium sulfate calculation. Should I be adding: 1. 65g of ammonium sulfate in 100 ml of...

09 July 2024 5,508 0 View

How to disperse silverparticles in water?

I synthesize silver nanoparticles ，and reserve it in water. Then, when I sonicate it some minutes or longer ,it couldn't be dispersed, most of them aggregate .Otherwise ,when I sonicate several...

09 July 2024 7,335 0 View

I require full text submission?

Good morning... I am conducting research on solar water pumping in residences, with water storage for night supply (non-existent sunlight) and I would like you to share your published article A...

26 June 2024 2,742 1 View

Why aren't primary MHD generators with tokamak/stellarator configurations studied/researched?

Magnetohydrodynamic generators are normally used as eihter an attachment to recycle wasted heat and flow of other generators, or used to absorb the energy from rocket thrusters. However, I'm...

24 June 2024 3,949 1 View

Challenges in Stabilizing and Concentrating a Highly Unstable Acetyltransferase for Crystallization?

I am working on an acetyltransferase that is highly unstable. Its pI is 6.65, and its molecular weight is around 18 kDa. The protein elutes at 1M imidazole and begins to precipitate immediately...

19 June 2024 2,590 0 View

How to Precipitate of Glucose?

Does someone know any precipitating agent to precipitate glucose from 10 % glucose solution? or to remove glucose from solution

13 June 2024 438 0 View

Why does the static pressure at the outlet become a very negative value when the outlet flow boundary conditions are used?

The simulation is for turbulent and incompressible flow and the inlet velocity condition is selected for the inlet

12 June 2024 3,568 2 View

How to precipitate dipeptide?

Hello I have synthesized a dipeptide in an aqueous media. Now I want to precipitate and filter it. How to precipitate it. Thank you in advance. Velmurugan S

11 June 2024 525 0 View