I have a protein construct in a pETDuet vector that I mutated in a TEV cut site (ENLYFQS) between the His-Tag-BamHI cutsite, and my protein of interest. Sequencing confirmed proper sequence (e.g. MGSSHHHHHHSQDPENLYFQS ) . However, the yield has reduced 10x fold compared to the unmutated construct. Everything looks good on the surface level, so I don't quite know why adding the TEV site would reduce my yields so much.
The mutation might change the conformation of the tagged protein as a whole, as a result of which it might be forming inclusion bodies and getting degraded. Strange things often happen during cloning!
Dear SAM
i don't think is the TEV site sequence itself that negatively affect the expression of your clone
i'm routinely using a variant of pet15 carrying at the N-term the sequence
MGSSHHHHHHENLYFQG (codified by atgggcagcagccatcatcatcatcatcacgaaaacctgtacttccagggc) and it guarantee high expression level for many different proteins.
I think that is more probable that the dna sequence that you introduce may induce some secondary RNA conformations that has negative impact on translation or you introduce rare codons. In this case you may solve the problem by other optimize the codons at the N-terms of for your sequence.
good luck
Manuele