Hello Kadir, some questions. How exactly did you clone EGFP into pET-28a? Did you confirm the sequence from the T7 promoter to the T7 terminator using forward and reverse sequencing reactions? Are you sure you transformed BL21(DE3) and were these made in-house or bought commercially? Can you share the confirmed sequence with us as a Word document? If you can, kindly provide the actual protocol you used. More information will help folks troubleshoot. I would avoid plating freshly transformed BL21(DE3) on LB agar containing IPTG. Generally speaking, you want to suppress expression of your protein of interest because it imposes a cellular stress and cells with mutated T7 RNAP, for example, will be selected for because it alleviates the stress. Instead try outgrowing the transformed cells in SOC media and then plating on SOB (NO IPTG). Include 100 mM glucose in your overnight liquid cultures for the same reason. It is also possible that the cloning is fine but there other factors at play (e.g., mRNA secondary structure preventing translation initiation, protein instability [unlikely for EGFP], etc.). Have you cloned other fluorescent proteins into pET-28a or were they cloned into different vectors?Thanks!

Hi Kadir, there are many possible reasons that could explain what you observe. It's not possibly to provide much guidance without looking at your plasmid design and plasmid sequencing data. Contact us at GenoFAB, we will help you https://genofab.com/pages/contact

Jamison Drew Law

Hello sir, unfortunately, I haven’t been able to get sequencing done yet since I haven’t observed any fluorescence. I am sharing my primers below. For EGFP, I used the SnapGene reference EGFP sequence, but I obtained the EGFP template from a plasmid that was previously used as a reporter in mammalian cell culture. I obtained the BL21(DE3) cells from another researcher who works with recombinant protein production.

As for the protocol, I cultured my cells in 10 mL of medium at 37°C until they reached an OD of 0.6, then I tried inducing with 10 µL or 50 µL of 100 mM IPTG. After induction, I incubated them at 37°C for 4 hours. In another experiment, I cultured 100 mL of OD 1.0 cells with 100 µL of IPTG and incubated them overnight at 20°C.

To determine whether the issue is with my plasmid, the cloned gene, or my protocols, I plan to clone the gene into a standard plasmid without His-tag. However, last night, I came across a video, and as seen in the photo I sent you, my liquid culture also had a similar greenish tint. Could it be that my cells are secreting EGFP into the medium despite the absence of any signal sequence?

https://www.youtube.com/watch?v=dfAXl9VFdX0

BamHI Forward :TATGGATCCATGGTGAGCAAGGGCGAG

EcorI Reverse seq : ATGGACGAGCTGTACAAGTAAGAATTCGCG

https://www.snapgene.com/plasmids/pet_and_duet_vectors_(novagen)/pET-28a(%2B)

Jean Peccoud

Hello Sir, Unfortunately, I don't have any sequencing data because we couldn't observe any fluorescence. Actually, I just performed standard cloning by adding BamHI and EcoRI restriction sites to the primers. However, this is my first time using the pET-28a vector. I will try a few more optimizations, especially with autoinduction, and hopefully, that will solve the issue.

Kadir, thank you for the additional information. You absolutely need to know the sequences of the vectors encoding 1) EGFP, 2) pET-28a [you seem to have this one], and 3) the final cloned product. The sequences of the first two must be known BEFORE you start cloning and the last one must be confirmed AFTER cloning and BEFORE proceeding to protein overexpression. This is standard protocol otherwise you take a huge risk wasting months worth of time— believe me it can happen I wasted 6 months on working with the incorrect clone. I think it would be best for you to start cloning afresh after getting the proper information. Ask for the sequence of the plasmid encoding EGFP that is being used as the template for PCR and ensure that its sequence is known and how it was confirmed. If you obtained pET-28a from Novagen then it is probably fine, but please check. Once you have the in silico files of each, make a new in silico file of pET-28a encoding EGFP (the product you expect following successful cloning) and then add the primers to each relevant file. If you wish, you can send me a private message to set up a Zoom call, that would be much easier than sending messages back to back. Please let me know if you have further questions.

Dear Kadir Aslan

just some questions:

how long id you induced at 37°C?

Did you check the sequence of your insert to see if it is correct?

Did you tried to reduce the induction temperature at 30°C or 25°C?

Since in my past experience. i waw that expression for 5h at 30°C or O/N at 25°C in LB provide highr GFP expression than 37°C.

Moreover, To my knowledge the expession of GFP in BL21(DE) is clearly detectable by eyes at the end of the culturee when you pellet the cells, since the cells become yellows.

When you are using brown media as LB or TB the yellow cannot be detectable once you will not centrifughe the cells and resuspend in a traspatent solution (e.g PBS) due to the colour and/or autofluorescence of the media.

At the minute 3 of the following video:

https://www.blogger.com/video.g?token=AD6v5dxhZKT6Tvug0rLIZgcg8nyl5CwzQSFiX9pLglN-foSxrhnBjoEr7ReFTWj5bbeiloMCNhNoJn2HgHEgR2eC7SYwl5TPVwlCYNniPhSpeELHsevHk1dREBGIdHqskofd9HgX-2gr

you can see an idea of a pellet of BL21(DE3) obtained using over expression in pet24 (which theoretically can be similar to pet28)

best regards

Manuele

Jamison Drew Law dear sir

Thank you very much for your help. I will try my best to follow your advice. However, in my current situation, unfortunately, obtaining any sequencing service is not possible. Initially, I planned to optimize some cloning methods and purification techniques before moving on to cloning my target P450 enzyme, but getting stuck at this early stage has been deeply frustrating for me.

So far, I have managed to find essential materials like DH5α, BL21(DE3), pET-28a, and IPTG through my connections, and I am trying to experiment with what I have. At this point, I will restart the cloning process from scratch and, instead of using IPTG induction, I will directly try autoinduction media to obtain green-colored pellets.

Since I used two different enzymes, I initially thought that issues like misintegration of the cloned gene or frameshift mutations would be very rare. However, struggling even with such a simple protein has been quite discouraging. Now, I plan to look for pET-24 or similar vectors from other universities, which only have a C-terminal His-tag. This way, I can ensure that my protein is produced without any additional sequences at the N-terminus.

I suspect that the main issue might be the large and nearly random N-terminal sequence present in pET-28a. I came across several papers discussing how the N-terminal His-tag or the extended N-terminal sequence in pET-28a can inactivate proteins. Hopefully, by switching to different vectors, I will be able to solve this issue.

Again, thank you very much for your support. I truly appreciate it!

Manuele Martinelli

Dear sir,

First of all, thank you very much for sharing your blog and introducing me to such a valuable platform. I have benefited from many of the contents in the blog and will continue to do so.

The example you provided contains an exceptional visual, something I couldn’t find even after extensive research online. Actually, I was expecting a pellet exactly like the one in that image, but unfortunately, it didn’t turn out that way.

When I checked the pET-24 vector in Novagen instead of SnapGene, I noticed that the His-tag is located at the C-terminal. I am currently trying to choose a similar vector because my pET-28a construct contains approximately 34 amino acids of signal sequence and spacer regions before coding my sequence.

I am wondering whether this could somehow be causing frameshift mutations, insolubility, or direct disruption of the three-dimensional structure. This might be the reason why I am not seeing a sufficient amount of the correct protein.

I see that you are working in this field, so I would like to ask you a few additional questions.

First, should I produce the protein extracellularly via a preplasmatic pathway using a plasmid containing a signal sequence, or should I keep it intracellular? I am planning to clone P450 enzyme derivatives. None of the enzymes I plan to clone contain rare codons, but since I will be measuring their activity afterward, they must remain functionally intact.

My second question is: What would you recommend for lysing my pellets to access these functional proteins? Unfortunately, I do not have access to expensive detergents like BugBuster.

Lastly, if you were to recommend a plasmid that only contains a C-terminal His-tag, which one would it be?

Thank you very much for your attention and help!