Can anyone suggest primers sequences for targeting 16s rDNA signature region of Bacteria in general?

More Asif Muhammad's questions See All

What is the standard procedure for disposal of ethanol? Can it be drained down the sink?

Can individual labs formulate their own procedure for disposal of chemicals or is there a universally recognized system of procedures for disposal of chemicals?

01 February 2016 4,129 3 View

Best tool for comparing multiple DNA sequence alignments?

Is there any nice online tool that can be used to evaluate different MSAs so we can decide which is the best alignment tool for a given set of nucleotides sequences.

31 December 2013 4,077 10 View

Best tool to build a phylogenetic tree for uncommon models?

This specially relates the models used in jmodeltest2, these models are not commonly encountered in common programs like MEGA etc. For example jmodeltest2 predicted 012030+G+F as the best model...

10 November 2013 3,962 4 View

Does anyone have an idea what this micro-organism could be?

The image is of fresh unstained culture under oil immersion. The other image is that of its colonies on LB agar.

06 July 2013 6,757 0 View

What is the composition of minimal media for growth of yeast?

I am looking for minimal set of components required for growth of yeast in general.

05 June 2013 7,403 1 View

How crucial could the quality of agar be for growth of bacteria (Arcobacter in particular)?

I was growing my Arcobacter happily using the recipe for Vandamme media (broth and agar). Then suddenly I had either poor growth or not growth in VD agar. All the ingredients were the same except...

04 May 2013 3,952 0 View

Can anyone suggest list of antibiotics which dont penetrate through cell membrane and therefore can be used for killing extracellular bacteria only?

Such antibiotics are used for killing extracellular bacteria during antibiotic protection assay for studying the intracellular survival of bacteria inside cells (macrophages etc). Gentamicin,...

11 December 2012 9,063 10 View

What is the exact mechanism of the antimicrobial effect of local anesthetics?

The antimicrobial effect of local anesthetics has been known for more than 50 years, but it still seems to have an unclear mechanism of action. which bacteria? which concentration? etc etc. ....

27 February 2021 4,450 2 View

Uncertianiny in using dry or wet basis in mixing a sediment with fuel oil?

Hello I'm currently working on a topic related to studying the anaerobic biodegradation of TPH in marine sediments. In this work, sediment should be mixed with fuel oil to a concentration of 20 g...

24 February 2021 9,839 3 View

Advice on growing lactobacillus species in the lab?

Hello everyone, For part of my PhD project, I'm hoping to grow some lactobacillus species in the lab so that I can create standard curves for a qPCR quantification of a faecal sample. However, I...

24 February 2021 3,157 6 View

What are the best cations for preparing competent cells, Ca2+ or Mg2+?

I have been reading various articles and most state that treatment with CaCl2 produces higher efficiency of transformation than MgCl2. Can anyone explain why Ca2+ is better than Mg2+ at...

16 February 2021 8,519 5 View

Would using an asRNA for repressing transcription of a high expression Listeria monocytogenes non-coding RNA harbored in a plasmid be a viable option?

Hello all, I am interested in deleting a highly expressed non-coding RNA located on a Listeria monocytogenes plasmid. Currently, there are not any optimized gene deletion methods for Listeria...

09 February 2021 4,994 1 View

Review Papers regarding transcriptional regulations & promoter types/classes in Gram positive bacteria?

Dear fellow researchers, Could you please suggest me excellent review papers discussing transcriptional regulations and/or promoter classes in Gram positive bacteria? Thank you so much for your help!

08 February 2021 6,909 3 View

Flexibility of RNAseq?

When you use RNAseq I understand that it must follow certain conditions when you use it. One of them is the insertion of a polyA tail. The insertion of the polyA must include then...

05 February 2021 3,770 4 View

How do microbes tell the presence of an inorganic minaral in the soil?

Due to their ubiquitous nature, there is a tendency of the presence of microbes in a given mineral(s). For instance, if microorganisms that love the of pH less than 6 in the pH value, is isolated...

03 February 2021 4,630 10 View

Moving bacteria-like organisms in my HEK293T cell culture?

Hi everyone, I have been culturing HEK293T cells that have been engineered to overexpress the mechanosensitive protein Piezo1. However, I am finding it very difficult to keep them in culture -...

02 February 2021 7,892 4 View

Qiime2- No reads passed the filter. How to set the trunc value?

Hi, I am working on some 16S sequencing data, and seems some of them are low quality. I am not sure how to set the trunc value in dada2. qiime dada2 denoise-paired \ --i-demultiplexed-seqs...

30 January 2021 6,213 3 View

Jayedul Hassan

I think you can use this primer sequence-

Uni16sF: 5 - aga gtt tga tcc tgg ctc ag - 3

Uni16sR: 5 - ctt gtg cgg gcc ccc gtc aat tc - 3

Yu Xia

We had ever used the following sequences for determination of gram-negative bacteria:

8F: 5'-AGAGTTTGATCCTGGCTCAG-3'

1391R: 5'-GACGGGCGGTGWGTRCA-3'

Muhammad Naveed

i have good amplification by using this primer pair for 16S at 54c annealing Temp,

P1 AGAGTTTGATCCTGGTCAGAACGAACGCT and P6 TACGGCTACCTTGTTACGACTTCACCCC