2 Questions 1 Answers 0 Followers
Questions related from Nadeem Khawar
can any budy explain how i calculate the DNA concentration for the 50ul reaction?
23 May 2024 9,672 1 View
If the sequence of the primers are given as: Forward: ATATAGACCAATATTCCTGTTAGCA, Reverse: AAAAATTAGCCGGGCGTAGTGGCG and size of the PCR product is 2500bp, then what will be the PCR profile for the...
23 May 2024 7,868 1 View