PBbB6c-GFP cloning problems?

14 December 2023 0 6K Report

hi everyone

we have been trying to clone a DNA fragment which has been double digested with EcoRI and XhoI (276 nt) and purified after gel electrophoresis into pBbB6c-GFP for months now, to no avail. usually after colony PCR, we see fragments that are around 300 nt longer than what we expect. we use pBRevBam and GGTGAGCCAGTGTGACTCTAG as forward and reverse primers for colony PCR.

has any one any experience with this vector?

Badges
Science topic

Similar topics
Phytochemistry
Extracts

More Mahsa Rasekhian's questions See All

How long should be stable a functionalized CNT? and how can I increase its stability?

I have functionalized MWCNT via both acidic and noncovalent rout, For acidic treatment I have used H2SO4:HNO3 (3:1) while ultrasonication at 55 C, and in non-covalent I used Triton x100, but the...

27 January 2021 4,497 3 View

What is the Melting point criterion in a MD simulation?

I need a quantitative criterion, something other than structural and visual qualitative features of melting in the molecular dynamics simulations.

26 January 2021 9,096 5 View

Athena IE in surrogate modeling?

I was wondering if anyone has deployed Athena IE in surrogate modeling or metamodels for LCA. There are many research involving data-based models for predicting energy consumption, but I haven't...

23 January 2021 2,267 1 View

Graphene model in CST?

Hi everyone, I wanna know about creating the Graphene model in CST. In: Macros -> Materials -> Create Graphene Material for Optical Applications. What is the exact formula that is used in this...

25 December 2020 1,938 4 View

How can I extract MCPD in oil and determination with GC-MS?

Hello everybody I am going to extract MCPD in oil ,but I havent pressurized liquid extraction. How can I extract MCPD in oil and determination with GC-MS?

20 December 2020 7,389 2 View

How can the SAR image be divided into two looks using the spectral diversity method?

Hello I'm working on SAR Images Co-registration.I want to divide my image into two looks with the spectral diversity method. But I did not find its complete formulas in any article. Does anyone...

13 December 2020 3,270 4 View

Are any Ph.D. programs or research labs working on Extraterrestrial habitat and greenhouse?

I am looking for opportunities to expand my research. Please let me know if you have any information. Just a note, I am available for collaboration on papers and projects.

19 October 2020 5,887 1 View

I want to know to calculate green and blue water in SWAT model,if the data is entered on a daily basis, can I receive the output on a daily basis too?

Hi everyone need your help.thank you

22 September 2020 8,704 4 View

How can i increase the pH of synthesic sea water to 12?

How can i increase the pH of sea water to 12? Because when i adding NaOH to seawater the pH does not go above 10 and begins to precipitate.

12 September 2020 564 9 View

How to measure the approximate mass of the attached layer to QCM-D silica coated sensor using the stitch function?

I am trying to form a covalently-bound layer of MPTMS on a QCM-D silica coated substrate, and want to use the stitch function in QTools to approximate the mass of the layer. I do not know which...

24 August 2020 2,076 3 View

How do I increase the yield of my PCR product?

Hello, We would like to increase the yield of our PCR product. We are running a series of PCR reactions that is targeting ~1.1kb sequence. We begin each reaction with ~400pg of template DNA...

02 March 2021 4,029 3 View

Does anyone know HRM channel in a 2 plex QIAGEN Rotor- Gene Q qPCR can be used as a separate channel?

I am going to have 3 different probes in my qPCR work that I am going to do. But I realized that the machine we have in the lab is a Rotor-Gene Q 2plex HRM Platform, saying it has green, yellow,...

01 March 2021 8,544 1 View

How to address this issue in the analysis of Real-Time PCR results?

To dear Researchers, I was analyzing a series of concentration for estimation of Real-Time PCR efficiency. The concentration was 1:10. I used MS-excel to evaluate Slope. The result of slope was -8...

01 March 2021 8,683 4 View

No title

Does anyone have the experience of using Taq Man probes in the QIAGEN Rotar- Gene qPCR machine?

01 March 2021 5,311 1 View

Anyone that can help with details in phosphopeptides enrichment?

Anyone know the amount of protein before enzymatic digestion for phosphopeptides enrichment of serume sample in Ti-IMAC? Has anyone ever use Ti-IMAC(the material is from Chinese company named...

28 February 2021 7,310 3 View

MiRNA qpcr problem?

Dear All, mirna primer showing some problem in the melting curve? any idea why? As attached is the melting curve. The forward sequence is obtained from miRBase and reverse primer is universal.

28 February 2021 5,008 4 View

Runs of nucleotides in Sanger sequencing?

I performed site directed mutagenesis, transformation, and then I sent out plasmids for Sanger sequencing and found out that there is extension of DNA just before the stop codon. I am not sure...

27 February 2021 547 3 View

Can thermal cycler machines be problematic during PCR?

Hi, my question is about the heating of thermal cycler machines and I hope some of you had experienced a similar thing previously. There are two thermal cycler machines in the lab(BioRad) and for...

26 February 2021 4,777 4 View

Calculating volume of DNA required from DNA concentration?

Hi I am a bit confused. They are asking me to find out the volume of DNA required in ul (a total of 30-100 ng for genomic DNA) from the DNA concentration in the nanodrop reading which was 404.8...

26 February 2021 5,029 2 View

Has anyone used the Illumina ITS1 primer sets?

Hi everyone, Illumina provides a list of primers to amplify with high taxonomic coverage the ITS1 region for further fungal sequencing, but I cannot find the exact amount necessary of each...

25 February 2021 6,969 3 View