Hi, 

There really isn't a kit to recommend. You already have the primers, you just need to PCR your samples. You will need to normalize your input for sequencing post PCR. we use the SequalPrep™ Normalization Plate Kit for this. Its a 96 well plate system. Its based on saturating the binding capacity in each well, washing off the excess and then eluting of the bound (same amount for each well) product. Then you will need to determine the concentration (molar) of the combined library pool so you can load at the concentration appropriate for the instrument. For 16s amplicon runs on the MiSeq I use a 20 pM library. If using custom primers (same primers used to generate the amplicon) for the sequencing there should be enough diversity to not require phiX to be added into the sequencing run.

I hope this was helpful, good luck

Frank

Hi Frank,

Thank you very much!!

May I ask additionally, possibly I misunderstood something:

we got tagged primers from a neighboring group, meaning that we have the locus specific primer with an additional 6 base long sequence (eg. AGTGAC, AGTGAG, etc., same at the fw and rev primer) in order to be able to distinguish between samples after MiSeq. I now thought there is another PCR necessary to ligate adapter sequences for subsequent binding to the sequencing slide and I was told that for this a special kit would be necessary fitting the sequencing machine. (Afterwards normalizing etc)

Is this right or could I combine tag and adapter addition to one PCR step?

Thanks a lot!

Andreas

Hi Andreas,

You can do them both in one step, but the primers would need to have the illumina adaptor sequences on them already. (for an example you can look at the earth microbiome project website for a general idea of what a "one step" system would look like http://www.earthmicrobiome.org/protocols-and-standards/16s/

It might be easier and less expensive to order a plate of primers with the illumina adaptors included and do the one step PCR (info on way to order etc at http://www.earthmicrobiome.org/protocols-and-standards/primer-ordering-and-resuspension/)  rather than get a kit to add illumina adaptors to the amplicons. 

If you want to make it a two stop approach you can do a second PCR (with limited number of cycles) using primes that contain your original primers and the illumina adaptors.

-          The primer to be ordered should have the following sequence:

o   Primer1: Illumina adapter + forward target primer

5’- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG -forward-primer-3’

o   Primer2: Illumina adapter + reverse target primer

5’- GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG -reverse-primer-3’

for 10-12 PCR cycles to add the adaptors. usually you would be adding indexes at this step. but it sounds like you have them on the first round primers, I am not sure how you would work with that, unless there is some common element outside the index sequence.

Another possibility is to A tail the amplicons and then ligate on the adaptors, this would allow you to keep any index and use common reagents. You can get kits for this from NEB or Illumina. 

Hope this is helpful,

Frank

Hi Frank!

Again thank you very much!!!!

Indeed this helps me a lot!!! I think to reorder primers to only have one amplification step; this should be less error-prone.

If I got it correctly, subsequent steps are then purification, normalization, and – if necessary – dilution before the product can be loaded to the Illumina. However, since we don't have the money for a sequencer this should then be done externally.

Hi Frank,

Illumina is suggesting a 2 PCR approach, with the first PCR including the adapter-sequence and the locus-specific primer and the 2nd also to include barcodes. Therefore I going to do it in this way (and don't use the primers we got :(

However, may I ask, how many cycles I should apply for the 2nd PCR, for the first round I consider 30 - 35 cycels.

Thanks in advance!

Andreas

Hi Andreas,

The method iluminated recommends fits using their  (expensive) kits.  I would limit second PCR to under 15 cycles. If your not going to be doing this in the future the Illumina kit cost vs ordering primers with adapters and index included  (earth microbiology approach) might be best. Even if using a two step method consider using custom sequencing primers so you don't waste sequencing through your own primers. This helps also by having sequence diversity from the start of the sequence, doing great this we don't have to add in Phx and maximizes useful reads.

Hi Frank!

Thanks again!!!!

What do you mean with custom primers? I would like to use the primers also used in the earth microbiome proj.

So "my" fw primer for the 1st PCR ist the one suggested by you in your second answer

5’- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG -forward-primer 515FB-3’

and primers for the 2nd PCR (one pair per sample) are indexed fw primer like

5’- AATGATACGGCGACCACCGAGATCTACAC index CGTCGGCAGCGTC-3'

Did I misunderstand you?