I found this molecule 2-amino purine which is fluorescent analog of adenine(6-amino purine), supposedly exciting at 300nm and emitting at 370nm roughly. This fluoresence is quenched when this (2-amino purine) base pairs with thymine on opposite strand. therefore this has an application to see signal when the dna strand is unwound. In y case, when i got the oligos separately, I did a excitation and emission spectrum scan on the 2-amino purine strand alone, being without its pair, it should fluoresce. I found that signal did exist at 310 excitation and 364 emission, which is close enough. But i feel there is too little signal (attached) even at the highest amount of templates 100uM while papers mention 1uM should work. This paper is an example of what am trying to do, DNA Unwinding Is the Primary Determinant of CRISPR-Cas9 Activity, Shanzhong Gong 1, Helen Hong Yu 1, Kenneth A Johnson 2, David W Taylor.

These are the sequences that i have copied from the paper,

DNA target strand: AGCTGACGTTTGTACTCCAGCGTCTCATCTTTATGCGTCAGCAGAGATTTCTGCT DNA 2-AP labeled nontarget strand: AGCAGAAATCTCTGCTG2APCGCATAAAGATGAGACGCTGGAGTACAAACGTCAGCT

so makes me believe any signal am getting is coming from the template. But if i do a concentration curve and my signal flatline when my concentration is below25uM so i feel it has to be higher, which means I have background. Am not sure if i can see the signal confidently with this assay, but seems like others have done it, so...

Any help would be very highly appreciated.

Feel free to message me on my linked in, linkedin.com/in/prince-panicker-ab0879a9